Stem-loop sequence gga-mir-146b

AccessionMI0003695 (change log)
DescriptionGallus gallus miR-146b stem-loop
Gene family MIPF0000103; mir-146
Literature search

14 open access papers mention gga-mir-146b
(55 sentences)

Stem-loop
   ----   ------cug      ug   uug          u       -    aaagc 
5'     gga         gcugcu  gcu   agaacugaau ccauagg cguu     a
       |||         ||||||  |||   |||||||||| ||||||| ||||      
3'     ccu         cgacgg  uga   ucuugacuua gguaucc guaa     u
   ccga   ccaaauaaa      gu   -cg          -       c    aaacc 
Get sequence
Deep sequencing
344689 reads, 5.48e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr6: 23143386-23143490 [+]
intergenic
Database links

Mature sequence gga-miR-146b-5p

Accession MIMAT0003351
Previous IDsgga-miR-146b
Sequence

19 - 

ugagaacugaauuccauaggcg

 - 40

Get sequence
Deep sequencing343705 reads, 5 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence gga-miR-146b-3p

Accession MIMAT0003724
Previous IDsgga-miR-146b*
Sequence

59 - 

cccuauggauucaguucugc

 - 78

Get sequence
Deep sequencing983 reads, 5 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).