Stem-loop sequence gga-mir-9-1

AccessionMI0003694 (change log)
DescriptionGallus gallus miR-9-1 stem-loop
Gene family MIPF0000014; mir-9
Literature search

19 open access papers mention gga-mir-9-1
(330 sentences)

Stem-loop
   uu    u       c c       a       g     g   a 
5'   gggu gguuuuu u uuugguu ucuagcu uauga ugu u
     |||| ||||||| | ||||||| ||||||| ||||| ||| g
3'   cucg ccaaaaa g aagccaa agaucga auacu aua u
   cg    c       u u       g       a     -   g 
Get sequence
Deep sequencing
6248151 reads, 6.37e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr28: 3623171-3623258 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-9-1
gga-mir-1621chr28: 3620263-3620333 [+]
gga-mir-1565chr28: 3621530-3621611 [+]
gga-mir-9-1chr28: 3623171-3623258 [+]
Database links

Mature sequence gga-miR-9-5p

Accession MIMAT0001195
Previous IDsgga-miR-9
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Deep sequencing23818269 reads, 5 experiments
Evidence by similarity; MI0000466

Mature sequence gga-miR-9-3p

Accession MIMAT0003350
Previous IDsgga-miR-9*
Sequence

54 - 

uaaagcuagagaaccgaaugu

 - 74

Get sequence
Deep sequencing293426 reads, 5 experiments
Evidence by similarity; MI0000466
Database links
Predicted targets