Stem-loop sequence gga-mir-9-1

Accession MI0003694
Description Gallus gallus miR-9-1 stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
uu    u       c c       a       g     g   a 
  gggu gguuuuu u uuugguu ucuagcu uauga ugu u
  |||| ||||||| | ||||||| ||||||| ||||| ||| g
  cucg ccaaaaa g aagccaa agaucga auacu aua u
cg    c       u u       g       a     -   g 
Get sequence
Genome context
Coordinates (Gallus-gallus-4.0) Overlapping transcripts
chr28: 3378847-3378934 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-9-1
gga-mir-1621 chr28: 3375877-3375947 [+]
gga-mir-1565 chr28: 3377144-3377225 [+]
gga-mir-9-1 chr28: 3378847-3378934 [+]
Database links

Mature sequence gga-miR-9-5p

Accession MIMAT0001195
Previous IDs gga-miR-9
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Evidence by similarity; MI0000466

Mature sequence gga-miR-9-3p

Accession MIMAT0003350
Previous IDs gga-miR-9*
Sequence

54 - 

uaaagcuagagaaccgaaugu

 - 74

Get sequence
Evidence by similarity; MI0000466
Predicted targets