Stem-loop sequence dre-mir-135a

Accession MI0003692
Description Danio rerio miR-135a stem-loop
Gene family MIPF0000028; mir-135
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
-----------aca    u     c   -      uu             a g ga 
              gcug cgugu uua uggcuu  uauuccuauguga g u  a
              |||| ||||| ||| ||||||  ||||||||||||| | |   
              ugac gcaca aau accgaa  auagggauguacu c g  c
uuucgacuaaagac    -     -   c      -c             - g aa
Get sequence
Genome context
Coordinates (Zv9) Overlapping transcripts
25: 32034712-32034809 [-]
intergenic
Database links

Mature sequence dre-miR-135a

Accession MIMAT0003348
Sequence

16 -  

uauggcuuuuuauuccuauguga

 - 38

Get sequence
Evidence experimental; array [1]

References

1
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).