Stem-loop sequence dre-mir-31

AccessionMI0003691 (change log)
DescriptionDanio rerio miR-31 stem-loop
Gene family MIPF0000064; mir-31
Literature search

8 open access papers mention dre-mir-31
(29 sentences)

Stem-loop
   ga           g   uu        -u  ua  g 
5'   agagauggcaa aug  ggcauagc  gu  au u
     ||||||||||| |||  ||||||||  ||  ||  
3'   ucuuuaccguu uac  ccguaucg  cg  ua u
   -g           a   cu        uc  gg  u 
Get sequence
Deep sequencing
4949 reads, 273 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr7: 73263751-73263822 [-]
intergenic
Database links

Mature sequence dre-miR-31

Accession MIMAT0003347
Sequence

8 - 

uggcaagauguuggcauagcug

 - 29

Get sequence
Deep sequencing4704 reads, 11 experiments
Evidence experimental; array [1], in-situ [1]
Database links
Predicted targets

References

1
PMID:15919954 "MicroRNA expression in zebrafish embryonic development" Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH Science. 309:310-311(2005).