Stem-loop sequence sv40-mir-S1

AccessionMI0003689
DescriptionSimian virus 40 miR-S1 stem-loop
Stem-loop
u     gac  u       ga     c      ga  c    gac 
 gaaca   ug gagggcu  ggggc ugaaau  gc uuga   u
 |||||   || |||||||  ||||| ||||||  || ||||   g
 cuugu   ac cuucuga  ucccg acuuug  cg aacu   u
u     ---  -       -g     u      uc  u    aag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence sv40-miR-S1-5p

Accession MIMAT0003344
Sequence

19 - 

ugaggggccugaaaugagccuu

 - 40

Get sequence
Evidence experimental; Northern [1]

Mature sequence sv40-miR-S1-3p

Accession MIMAT0003345
Sequence

57 - 

gccuguuucaugcccugagu

 - 76

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:15931223 "SV40-encoded microRNAs regulate viral gene expression and reduce susceptibility to cytotoxic T cells" Sullivan CS, Grundhoff AT, Tevethia S, Pipas JM, Ganem D Nature. 435:682-686(2005).