Stem-loop sequence hsa-mir-542

Accession MI0003686
Symbol HGNC:MIR542
Description Homo sapiens miR-542 stem-loop
Gene family MIPF0000185; mir-542
Stem-loop
----------caga        auc    gg    uca         -a   c 
              ucucagac   ucgg  auca   ugucacgag  uac a
              ||||||||   ||||  ||||   |||||||||  |||  
              agggucug   aguc  uagu   acaguguuc  gug g
acuucuacucaccg        gaa    aa    uag         ac   u 
Get sequence
Deep sequencing
4612 reads, 1.18e+03 reads per million, 62 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 133675371-133675467 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-542
hsa-mir-424 chrX: 133680644-133680741 [-]
hsa-mir-503 chrX: 133680358-133680428 [-]
hsa-mir-542 chrX: 133675371-133675467 [-]
hsa-mir-450a-2 chrX: 133674538-133674637 [-]
hsa-mir-450a-1 chrX: 133674371-133674461 [-]
hsa-mir-450b chrX: 133674215-133674292 [-]
Database links

Mature sequence hsa-miR-542-5p

Accession MIMAT0003340
Sequence

16 - 

ucggggaucaucaugucacgaga

 - 38

Get sequence
Deep sequencing 804 reads, 40 experiments
Evidence experimental; cloned [16274478,17604727,17616659]
Validated targets
Predicted targets

Mature sequence hsa-miR-542-3p

Accession MIMAT0003389
Sequence

53 - 

ugugacagauugauaacugaaa

 - 74

Get sequence
Deep sequencing 3797 reads, 58 experiments
Evidence experimental; cloned [16274478,17604727]
Validated targets
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).