Stem-loop sequence hsa-mir-421

AccessionMI0003685
Symbol HGNC:MIR421
DescriptionHomo sapiens miR-421 stem-loop
Gene family MIPF0000098; mir-95
Stem-loop
   ----g    uu      -    uua            a   aaa 
5'      caca  guaggc cuca   aauguuuguuga uga   a
        ||||  |||||| ||||   |||||||||||| |||   a
3'      gugu  cguccg gggu   uuacagacaacu acu   u
   cucua    cu      c    uaa            -   aag 
Get sequence
Deep sequencing
2386 reads, 409 reads per million, 62 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chrX: 74218377-74218461 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-421
hsa-mir-374cchrX: 74218549-74218618 [+]
hsa-mir-374bchrX: 74218547-74218618 [-]
hsa-mir-421chrX: 74218377-74218461 [-]
Database links

Mature sequence hsa-miR-421

Accession MIMAT0003339
Sequence

48 - 

aucaacagacauuaauugggcgc

 - 70

Get sequence
Deep sequencing1422 reads, 49 experiments
Evidence experimental; Microarray [1], SAGE [1], cloned [2]
Validated targets
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).