Stem-loop sequence hsa-mir-421

AccessionMI0003685 (change log)
Symbol HGNC:MIR421
DescriptionHomo sapiens miR-421 stem-loop
Gene family MIPF0000098; mir-95
Literature search

50 open access papers mention hsa-mir-421
(142 sentences)

Stem-loop
   ----g    uu      -    uua            a   aaa 
5'      caca  guaggc cuca   aauguuuguuga uga   a
        ||||  |||||| ||||   |||||||||||| |||   a
3'      gugu  cguccg gggu   uuacagacaacu acu   u
   cucua    cu      c    uaa            -   aag 
Get sequence
Deep sequencing
66453 reads, 121 reads per million, 151 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 74218377-74218461 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-421
hsa-mir-374cchrX: 74218549-74218618 [+]
hsa-mir-374bchrX: 74218547-74218618 [-]
hsa-mir-421chrX: 74218377-74218461 [-]
Database links

Mature sequence hsa-miR-421

Accession MIMAT0003339
Sequence

48 - 

aucaacagacauuaauugggcgc

 - 70

Get sequence
Deep sequencing66205 reads, 152 experiments
Evidence experimental; Microarray [1], SAGE [1], cloned [2]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).