Stem-loop sequence hsa-mir-659

AccessionMI0003683 (change log)
Symbol HGNC:MIR659
DescriptionHomo sapiens miR-659 stem-loop
Literature search

19 open access papers mention hsa-mir-659
(119 sentences)

Stem-loop
   uaccgacccuc   uug   ca                         uc 
5'            gau   guu  ggaccuucccugaaccaaggaagag  a
              |||   |||  |||||||||||||||||||||||||  c
3'            cug   caa  ccugggagggacuugguuccuucuc  a
   ----gguacuc   uaa   cc                         ug 
Get sequence
Deep sequencing
925 reads, 1 reads per million, 100 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 37847678-37847774 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-659
hsa-mir-659chr22: 37847678-37847774 [-]
hsa-mir-658chr22: 37844272-37844371 [-]
Database links

Mature sequence hsa-miR-659-5p

Accession MIMAT0022710
Sequence

22 - 

aggaccuucccugaaccaagga

 - 43

Get sequence
Deep sequencing872 reads, 92 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-659-3p

Accession MIMAT0003337
Previous IDshsa-miR-659
Sequence

61 - 

cuugguucagggagggucccca

 - 82

Get sequence
Deep sequencing43 reads, 33 experiments
Evidence experimental; Microarray [1], SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).