|
miRBase |
|
Stem-loop sequence hsa-mir-549a |
|||||
| Accession | MI0003679 | ||||
| Previous IDs | hsa-mir-549 | ||||
| Symbol | HGNC:MIR549 | ||||
| Description | Homo sapiens miR-549 stem-loop | ||||
| Gene family | MIPF0000470; mir-549 | ||||
| Stem-loop |
agacaugcaacucaaga ucu
auauauugagagcucauccauaguugucacug c
||||||||||||||||||||||||||||||||
uauauaauucucgaguagguaucaacagugac a
----------cggaccc uaa
|
||||
| Deep sequencing |
| ||||
| Comments |
Cummins et al report two mature isoforms that map to the same precursor locus, referred to as miR-549a (shown here) and miR-549b (two nt longer at the 3' end - GACAACUAUGGAUGAGCUCUCA) [1]. |
||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-549a |
|
| Accession | MIMAT0003333 |
| Previous IDs | hsa-miR-549 |
| Sequence |
61 - ugacaacuauggaugagcucu - 81 |
| Deep sequencing | 15 reads, 2 experiments |
| Evidence | experimental; SAGE [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16505370
"The colorectal microRNAome"
Proc Natl Acad Sci U S A. 103:3687-3692(2006).
|