Stem-loop sequence hsa-mir-549a

Accession MI0003679
Previous IDs hsa-mir-549
Symbol HGNC:MIR549
Description Homo sapiens miR-549 stem-loop
Gene family MIPF0000470; mir-549
Stem-loop 
agacaugcaacucaaga                                ucu 
                 auauauugagagcucauccauaguugucacug   c
                 ||||||||||||||||||||||||||||||||    
                 uauauaauucucgaguagguaucaacagugac   a
----------cggaccc                                uaa
Get sequence
Deep sequencing
17 reads, 4 experiments
Comments

Cummins et al report two mature isoforms that map to the same precursor locus, referred to as miR-549a (shown here) and miR-549b (two nt longer at the 3' end - GACAACUAUGGAUGAGCUCUCA) [1].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr15: 81134319-81134414 [-]
antisense
OTTHUMT00000313749 ; KIAA1199-003; intron 1
OTTHUMT00000291389 ; KIAA1199-001; intron 1
OTTHUMT00000313748 ; KIAA1199-002; intron 1
OTTHUMT00000313749 ; AC027808.1-003; intron 1
OTTHUMT00000291389 ; AC027808.1-001; intron 1
OTTHUMT00000313748 ; AC027808.1-002; intron 1
OTTHUMT00000313749 ; AC027808.1-003; intron 1
OTTHUMT00000291389 ; AC027808.1-001; intron 1
OTTHUMT00000313748 ; AC027808.1-002; intron 1
ENST00000220244 ; KIAA1199-003; intron 1
ENST00000394685 ; KIAA1199-001; intron 1
ENST00000356249 ; KIAA1199-002; intron 1
ENST00000394683 ; KIAA1199-201; intron 1
ENST00000220244 ; KIAA1199-003; intron 1
ENST00000394685 ; KIAA1199-001; intron 1
ENST00000356249 ; KIAA1199-002; intron 1
ENST00000394683 ; KIAA1199-201; intron 1
ENST00000220244 ; KIAA1199-003; intron 1
ENST00000394685 ; KIAA1199-001; intron 1
ENST00000356249 ; KIAA1199-002; intron 1
Database links

Mature sequence hsa-miR-549a

Accession MIMAT0003333
Previous IDs hsa-miR-549
Sequence

61 -  

ugacaacuauggaugagcucu

 - 81

Get sequence
Deep sequencing 15 reads, 2 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).