Stem-loop sequence hsa-mir-656

AccessionMI0003678 (change log)
Symbol HGNC:MIR656
DescriptionHomo sapiens miR-656 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   ----------cu    u      c     ag       cuu  u 
5'             gaaa agguug cugug  guguuca   uc a
               |||| |||||| |||||  |||||||   || u
3'             cuuu uccaac gacau  uauaagu   ag a
   cuaagcuauagc    c      u     au       ---  u 
Get sequence
Deep sequencing
183 reads, 3.85 reads per million, 26 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101066724-101066801 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-656
hsa-mir-154chr14: 101059755-101059838 [+]
hsa-mir-496chr14: 101060573-101060674 [+]
hsa-mir-377chr14: 101062050-101062118 [+]
hsa-mir-541chr14: 101064495-101064578 [+]
hsa-mir-409chr14: 101065300-101065378 [+]
hsa-mir-412chr14: 101065447-101065537 [+]
hsa-mir-369chr14: 101065598-101065667 [+]
hsa-mir-410chr14: 101065912-101065991 [+]
hsa-mir-656chr14: 101066724-101066801 [+]
Database links

Mature sequence hsa-miR-656-5p

Accession MIMAT0026627
Sequence

8 - 

agguugccugugagguguuca

 - 28

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-656-3p

Accession MIMAT0003332
Sequence

43 - 

aauauuauacagucaaccucu

 - 63

Get sequence
Deep sequencing180 reads, 25 experiments
Evidence experimental; Microarray [1], RT-PCR [1], SAGE [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).