Stem-loop sequence hsa-mir-655

AccessionMI0003677 (change log)
Symbol HGNC:MIR655
DescriptionHomo sapiens miR-655 stem-loop
Gene family MIPF0000018; mir-154
Literature search

13 open access papers mention hsa-mir-655
(314 sentences)

Stem-loop
   aacuaugcaag      ug           u      ua      cuuca 
5'            gauauu  aggagagguua ccgugu  uguucg     u
              ||||||  ||||||||||| ||||||  ||||||      
3'            cuauaa  uuuucuccaau gguaca  auaagu     u
   -----cucaga      gu           u      ua      acuac 
Get sequence
Deep sequencing
5788 reads, 6.96 reads per million, 115 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101049550-101049646 [+]
antisense
OTTHUMT00000414335 ; BEGAIN-006; intron 1
ENST00000554140 ; BEGAIN-006; intron 1
Clustered miRNAs
< 10kb from hsa-mir-655
hsa-mir-376cchr14: 101039690-101039755 [+]
hsa-mir-376a-2chr14: 101040069-101040148 [+]
hsa-mir-654chr14: 101040219-101040299 [+]
hsa-mir-376bchr14: 101040436-101040535 [+]
hsa-mir-376a-1chr14: 101040782-101040849 [+]
hsa-mir-300chr14: 101041363-101041445 [+]
hsa-mir-1185-1chr14: 101042977-101043062 [+]
hsa-mir-1185-2chr14: 101044198-101044283 [+]
hsa-mir-381chr14: 101045920-101045994 [+]
hsa-mir-487bchr14: 101046455-101046538 [+]
hsa-mir-539chr14: 101047321-101047398 [+]
hsa-mir-889chr14: 101047901-101047979 [+]
hsa-mir-544achr14: 101048658-101048748 [+]
hsa-mir-655chr14: 101049550-101049646 [+]
hsa-mir-487achr14: 101052446-101052525 [+]
hsa-mir-382chr14: 101054306-101054381 [+]
hsa-mir-134chr14: 101054687-101054759 [+]
hsa-mir-668chr14: 101055258-101055323 [+]
hsa-mir-485chr14: 101055419-101055491 [+]
hsa-mir-323bchr14: 101056219-101056300 [+]
Database links

Mature sequence hsa-miR-655-5p

Accession MIMAT0026626
Sequence

23 - 

agagguuauccguguuauguuc

 - 44

Get sequence
Deep sequencing23 reads, 14 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence hsa-miR-655-3p

Accession MIMAT0003331
Sequence

61 - 

auaauacaugguuaaccucuuu

 - 82

Get sequence
Deep sequencing5745 reads, 112 experiments
Evidence experimental; Microarray [1], RT-PCR [1], SAGE [1], cloned [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).