Stem-loop sequence hsa-mir-654

AccessionMI0003676 (change log)
Symbol HGNC:MIR654
DescriptionHomo sapiens miR-654 stem-loop
Gene family MIPF0000409; mir-654
Stem-loop
       aagugg    a      g c     a      - -  a 
5' gggu      aaag uggugg c gcaga caugug c ug g
   ||||      |||| |||||| | ||||| |||||| | ||  
3' cccg      uuuc acuacc g cgucu guauac g gc u
       --aaga    c      a u     -      c u  u 
Get sequence
Deep sequencing
1456 reads, 13.6 reads per million, 44 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101040219-101040299 [+]
antisense
OTTHUMT00000414335 ; BEGAIN-006; intron 1
ENST00000554140 ; BEGAIN-006; intron 1
Clustered miRNAs
< 10kb from hsa-mir-654
hsa-mir-543chr14: 101031987-101032064 [+]
hsa-mir-495chr14: 101033755-101033836 [+]
hsa-mir-376cchr14: 101039690-101039755 [+]
hsa-mir-376a-2chr14: 101040069-101040148 [+]
hsa-mir-654chr14: 101040219-101040299 [+]
hsa-mir-376bchr14: 101040436-101040535 [+]
hsa-mir-376a-1chr14: 101040782-101040849 [+]
hsa-mir-300chr14: 101041363-101041445 [+]
hsa-mir-1185-1chr14: 101042977-101043062 [+]
hsa-mir-1185-2chr14: 101044198-101044283 [+]
hsa-mir-381chr14: 101045920-101045994 [+]
hsa-mir-487bchr14: 101046455-101046538 [+]
hsa-mir-539chr14: 101047321-101047398 [+]
hsa-mir-889chr14: 101047901-101047979 [+]
hsa-mir-544achr14: 101048658-101048748 [+]
hsa-mir-655chr14: 101049550-101049646 [+]
Database links

Mature sequence hsa-miR-654-5p

Accession MIMAT0003330
Previous IDshsa-miR-654
Sequence

16 - 

uggugggccgcagaacaugugc

 - 37

Get sequence
Deep sequencing155 reads, 9 experiments
Evidence experimental; Microarray [1], SAGE [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-654-3p

Accession MIMAT0004814
Sequence

51 - 

uaugucugcugaccaucaccuu

 - 72

Get sequence
Deep sequencing1300 reads, 41 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).