Stem-loop sequence hsa-mir-411

AccessionMI0003675 (change log)
Symbol HGNC:MIR411
DescriptionHomo sapiens miR-411 stem-loop
Gene family MIPF0000126; mir-379
Literature search

33 open access papers mention hsa-mir-411
(135 sentences)

Stem-loop
   --------------       ug   a a    a      a a       - uuu 
5'               ugguacu  gag g uagu gaccgu u gcguacg c   a
                 |||||||  ||| | |||| |||||| | ||||||| |   u
3'               acuauga  cuc c auca cuggca a uguaugc g   c
   gagccccuaccuaa       --   c a    c      c a       a ugu 
Get sequence
Deep sequencing
52615 reads, 86.6 reads per million, 134 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101023325-101023420 [+]
antisense
OTTHUMT00000414334 ; BEGAIN-007; intron 1
OTTHUMT00000414329 ; BEGAIN-001; intron 2
OTTHUMT00000414331 ; BEGAIN-005; intron 2
OTTHUMT00000414332 ; BEGAIN-003; intron 2
OTTHUMT00000414335 ; BEGAIN-006; intron 2
OTTHUMT00000414337 ; BEGAIN-004; intron 2
ENST00000557378 ; BEGAIN-007; intron 1
ENST00000443071 ; BEGAIN-201; intron 1
ENST00000355173 ; BEGAIN-001; intron 2
ENST00000553553 ; BEGAIN-005; intron 2
ENST00000556188 ; BEGAIN-003; intron 2
ENST00000554140 ; BEGAIN-006; intron 2
ENST00000554747 ; BEGAIN-004; intron 2
Clustered miRNAs
< 10kb from hsa-mir-411
hsa-mir-379chr14: 101022066-101022132 [+]
hsa-mir-411chr14: 101023325-101023420 [+]
hsa-mir-299chr14: 101023794-101023856 [+]
hsa-mir-380chr14: 101025017-101025077 [+]
hsa-mir-1197chr14: 101025564-101025651 [+]
hsa-mir-323achr14: 101025732-101025817 [+]
hsa-mir-758chr14: 101026020-101026107 [+]
hsa-mir-329-1chr14: 101026785-101026864 [+]
hsa-mir-329-2chr14: 101027100-101027183 [+]
hsa-mir-494chr14: 101029634-101029714 [+]
hsa-mir-1193chr14: 101030052-101030129 [+]
hsa-mir-543chr14: 101031987-101032064 [+]
Database links

Mature sequence hsa-miR-411-5p

Accession MIMAT0003329
Previous IDshsa-miR-411
Sequence

16 - 

uaguagaccguauagcguacg

 - 36

Get sequence
Deep sequencing48977 reads, 128 experiments
Evidence experimental; Microarray [1], RT-PCR [1], SAGE [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-411-3p

Accession MIMAT0004813
Previous IDshsa-miR-411*
Sequence

51 - 

uauguaacacgguccacuaacc

 - 72

Get sequence
Deep sequencing3634 reads, 120 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).