Stem-loop sequence hsa-mir-653

AccessionMI0003674 (change log)
Symbol HGNC:MIR653
DescriptionHomo sapiens miR-653 stem-loop
Gene family MIPF0000435; mir-653
Literature search

8 open access papers mention hsa-mir-653
(9 sentences)

Stem-loop
   -----------u      cuu              u     c     cagcu 
5'             ucauuc   caguguugaaacaa cucua ugaac     u
               ||||||   |||||||||||||| ||||| |||||     c
3'             aguaag   guuauaacuuuguu gaggu acuug     a
   cgaagguagaau      aac              u     c     aacaa 
Get sequence
Deep sequencing
1136 reads, 0 reads per million, 111 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 93482760-93482855 [-]
antisense
OTTHUMT00000342070 ; GNGT1-005; intron 1
ENST00000455502 ; GNGT1-005; intron 1
Clustered miRNAs
< 10kb from hsa-mir-653
hsa-mir-489chr7: 93483936-93484019 [-]
hsa-mir-653chr7: 93482760-93482855 [-]
Database links

Mature sequence hsa-miR-653-5p

Accession MIMAT0003328
Sequence

13 - 

guguugaaacaaucucuacug

 - 33

Get sequence
Deep sequencing661 reads, 94 experiments
Evidence experimental; SAGE [1], cloned [2], Illumina [3]
Database links
Predicted targets

Mature sequence hsa-miR-653-3p

Accession MIMAT0026625
Sequence

51 - 

uucacuggaguuuguuucaaua

 - 72

Get sequence
Deep sequencing474 reads, 93 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).