Stem-loop sequence hsa-mir-653

Accession

MI0003674

Symbol

HGNC:MIR653

Description

Homo sapiens miR-653 stem-loop

Gene family

MIPF0000435; mir-653

Stem-loop

-----------u      cuu              u     c     cagcu 
            ucauuc   caguguugaaacaa cucua ugaac     u
            ||||||   |||||||||||||| ||||| |||||     c
            aguaag   guuauaacuuuguu gaggu acuug     a
cgaagguagaau      aac              u     c     aacaa 

Deep sequencing

34 reads, 14 experiments

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCh37.p5): chr7: 93112072-93112167 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000341742 ; CALCR-003; intron 1

  OTTHUMT00000341743 ; CALCR-004; intron 1

  OTTHUMT00000341742 ; CALCR-003; intron 1

  OTTHUMT00000341743 ; CALCR-004; intron 1

  OTTHUMT00000341742 ; CALCR-003; intron 1

  OTTHUMT00000341743 ; CALCR-004; intron 1

  OTTHUMT00000254661 ; CALCR-002; intron 2

  OTTHUMT00000254661 ; CALCR-002; intron 2

  OTTHUMT00000254661 ; CALCR-002; intron 2

  OTTHUMT00000341741 ; CALCR-001; intron 3

  OTTHUMT00000341744 ; CALCR-005; intron 3

  OTTHUMT00000341741 ; CALCR-001; intron 3

  OTTHUMT00000341744 ; CALCR-005; intron 3

  OTTHUMT00000341741 ; CALCR-001; intron 3

  OTTHUMT00000341744 ; CALCR-005; intron 3

  ENST00000423724 ; CALCR-003; intron 1

  ENST00000415529 ; CALCR-004; intron 1

  ENST00000535783 ; CALCR-203; intron 1

  ENST00000423724 ; CALCR-003; intron 1

  ENST00000415529 ; CALCR-004; intron 1

  ENST00000535783 ; CALCR-203; intron 1

  ENST00000423724 ; CALCR-003; intron 1

  ENST00000415529 ; CALCR-004; intron 1

  ENST00000394441 ; CALCR-002; intron 2

  ENST00000394441 ; CALCR-002; intron 2

  ENST00000394441 ; CALCR-002; intron 2

  ENST00000421592 ; CALCR-001; intron 3

  ENST00000426151 ; CALCR-005; intron 3

  ENST00000360249 ; CALCR-202; intron 3

  ENST00000421592 ; CALCR-001; intron 3

  ENST00000426151 ; CALCR-005; intron 3

  ENST00000360249 ; CALCR-202; intron 3

  ENST00000421592 ; CALCR-001; intron 3

  ENST00000426151 ; CALCR-005; intron 3

  ENST00000360249 ; CALCR-202; intron 3

  ENST00000359558 ; CALCR-201; intron 4

  ENST00000359558 ; CALCR-201; intron 4

  ENST00000359558 ; CALCR-201; intron 4

Clustered miRNAs

< 10kb from hsa-mir-653

• hsa-mir-489: chr7: 93113248-93113331 [-]
• hsa-mir-653: chr7: 93112072-93112167 [-]

Database links

• ENTREZGENE: 724023;MIR653
• HGNC: 32909;MIR653

Mature sequence hsa-miR-653

• Accession: MIMAT0003328
• Sequence: 13 - guguugaaacaaucucuacug - 33
• Deep sequencing: 12 reads, 6 experiments
• Evidence: experimental; SAGE [1], cloned [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-653
  • MICRORNA.ORG:hsa-miR-653
  • MIRDB:hsa-miR-653
  • RNA22-HSA:hsa-miR-653
  • TARGETMINER:hsa-miR-653
  • TARGETSCAN-VERT:hsa-miR-653

References

1. PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).