Stem-loop sequence hsa-mir-449b

AccessionMI0003673
Symbol HGNC:MIR449B
DescriptionHomo sapiens miR-449b stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   ---------uga  u   u     a     u   uu   a c        u  gu 
5'             cc gaa caggu ggcag gua  guu g uggcugcu gg  c
               || ||| ||||| ||||| |||  ||| | |||||||| ||   
3'             gg cuu guuca ccguc cau  caa c accgacga cu  a
   ucuucuuaaaua  u   c     -     c   --   - -        -  ga 
Get sequence
Deep sequencing
605 reads, 195 reads per million, 26 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr5: 55170646-55170742 [-]
antisense
OTTHUMT00000313798 ; IL31RA-004; intron 4
OTTHUMT00000214148 ; IL31RA-001; intron 4
OTTHUMT00000313797 ; IL31RA-003; intron 4
OTTHUMT00000313799 ; IL31RA-005; intron 5
OTTHUMT00000313796 ; IL31RA-002; intron 6
ENST00000297015 ; IL31RA-201; intron 3
ENST00000396836 ; IL31RA-004; intron 4
ENST00000447346 ; IL31RA-001; intron 4
ENST00000359040 ; IL31RA-003; intron 4
ENST00000354961 ; IL31RA-202; intron 4
ENST00000490985 ; IL31RA-005; intron 5
ENST00000396834 ; IL31RA-002; intron 6
Clustered miRNAs
< 10kb from hsa-mir-449b
hsa-mir-449cchr5: 55172262-55172353 [-]
hsa-mir-449bchr5: 55170646-55170742 [-]
hsa-mir-449achr5: 55170532-55170622 [-]
Database links

Mature sequence hsa-miR-449b-5p

Accession MIMAT0003327
Previous IDshsa-miR-449b
Sequence

16 - 

aggcaguguauuguuagcuggc

 - 37

Get sequence
Deep sequencing75 reads, 9 experiments
Evidence experimental; Microarray [1], RT-PCR [1], SAGE [1], cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-449b-3p

Accession MIMAT0009203
Previous IDshsa-miR-449b*
Sequence

55 - 

cagccacaacuacccugccacu

 - 76

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; 454 [3]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:19144710 "Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas" Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G J Virol. 83:3333-3341(2009).