Stem-loop sequence hsa-mir-663a

AccessionMI0003672 (change log)
Previous IDshsa-mir-663
Symbol HGNC:MIR663A
DescriptionHomo sapiens miR-663a stem-loop
Gene family MIPF0000462; mir-663
Literature search

75 open access papers mention hsa-mir-663a
(533 sentences)

Stem-loop
   -ccuu    c   -     -c  g   -        --     c   ug 
5'      ccgg guc ccagg  gg gcg ccgcggga  ccgcc ucg  u
        |||| ||| |||||  || ||| ||||||||  ||||| |||   
3'      ggcc cgg ggucc  uu ugc ggcgcccu  ggugg ggu  c
   guacc    -   u     uu  g   c        ag     c   gu 
Get sequence
Deep sequencing
2275 reads, 10.5 reads per million, 133 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 26208186-26208278 [-]
sense
OTTHUMT00000461918 ; RP3-410C9.1-006; intron 1
OTTHUMT00000461919 ; RP3-410C9.1-005; intron 1
OTTHUMT00000461922 ; RP3-410C9.1-007; intron 1
OTTHUMT00000461923 ; RP3-410C9.1-004; intron 1
ENST00000601901 ; MIR663A-006; intron 1
ENST00000594130 ; MIR663A-005; intron 1
ENST00000596767 ; MIR663A-007; intron 1
ENST00000601119 ; MIR663A-004; intron 1
Database links

Mature sequence hsa-miR-663a

Accession MIMAT0003326
Previous IDshsa-miR-663
Sequence

15 - 

aggcggggcgccgcgggaccgc

 - 36

Get sequence
Deep sequencing367 reads, 84 experiments
Evidence experimental; SAGE [1]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).