Stem-loop sequence hsa-mir-662

AccessionMI0003670
Symbol HGNC:MIR662
DescriptionHomo sapiens miR-662 stem-loop
Gene family MIPF0000492; mir-662
Stem-loop
     ugu  a        a  ca    c     g     u    -g   g 
5' gc   ug ggcugcgc gc  ggcc ugacg ugggg ggcu  cgg c
   ||   || |||||||| ||  |||| ||||| ||||| ||||  ||| c
3' cg   gc cugacgcg cg  ccgg guugc acccu cugg  guc u
     -uu  a        a  ac    u     -     -    aa   u 
Get sequence
Deep sequencing
7 reads, 65.2 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr16: 770183-770277 [+]
intergenic
Database links

Mature sequence hsa-miR-662

Accession MIMAT0003325
Sequence

61 - 

ucccacguuguggcccagcag

 - 81

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).