Stem-loop sequence hsa-mir-548d-1

AccessionMI0003668
Symbol HGNC:MIR548D1
DescriptionHomo sapiens miR-548d-1 stem-loop
Gene family MIPF0000317; mir-548
Stem-loop
   aaacaaguua      g            u                uguaa 
5'           uauuag uuggugcaaaag aauugugguuuuugcc     a
             |||||| |||||||||||| ||||||||||||||||      
3'           auaauc gaccacguuuuc uugacaccaaaaacgg     a
   -------gaa      a            u                uaaug 
Get sequence
Deep sequencing
823 reads, 341 reads per million, 57 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr8: 123348034-123348130 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-548d-1
hsa-mir-548aa-1chr8: 123348034-123348130 [+]
hsa-mir-548d-1chr8: 123348034-123348130 [-]
Database links

Mature sequence hsa-miR-548d-5p

Accession MIMAT0004812
Sequence

25 - 

aaaaguaauugugguuuuugcc

 - 46

Get sequence
Deep sequencing381 reads, 32 experiments
Evidence experimental; cloned [2]
Predicted targets

Mature sequence hsa-miR-548d-3p

Accession MIMAT0003323
Previous IDshsa-miR-548d
Sequence

61 - 

caaaaaccacaguuucuuuugc

 - 82

Get sequence
Deep sequencing78 reads, 12 experiments
Evidence experimental; RT-PCR [1], SAGE [1], cloned [2]
Validated targets
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).