Stem-loop sequence hsa-mir-652

AccessionMI0003667 (change log)
Symbol HGNC:MIR652
DescriptionHomo sapiens miR-652 stem-loop
Gene family MIPF0000333; mir-652
Literature search

34 open access papers mention hsa-mir-652
(107 sentences)

Stem-loop
   acgaau  cua                  gagag           ca  g 
5'       gg   ugcacugcacaacccuag     ggugccauuca  ua a
         ||   ||||||||||||||||||     |||||||||||  || c
3'       cc   acgugacguguugggauc     ccgcgguaagu  au u
   -cacau  aac                  ----a           ua  a 
Get sequence
Deep sequencing
77353 reads, 189 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 3' end of the miRNA is offset with respect to previous annotations. miR-652 cloned in [2] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 110055329-110055426 [+]
intergenic
Database links

Mature sequence hsa-miR-652-5p

Accession MIMAT0022709
Sequence

21 - 

caacccuaggagagggugccauuca

 - 45

Get sequence
Deep sequencing4419 reads, 150 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-652-3p

Accession MIMAT0003322
Previous IDshsa-miR-652
Sequence

61 - 

aauggcgccacuaggguugug

 - 81

Get sequence
Deep sequencing72865 reads, 159 experiments
Evidence experimental; Microarray [1], SAGE [1], cloned [2]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).