Stem-loop sequence hsa-mir-652

Accession MI0003667
Symbol HGNC:MIR652
Description Homo sapiens miR-652 stem-loop
Gene family MIPF0000333; mir-652
Stem-loop 
acgaau  cua                  gagag           ca  g 
      gg   ugcacugcacaacccuag     ggugccauuca  ua a
      ||   ||||||||||||||||||     |||||||||||  || c
      cc   acgugacguguugggauc     ccgcgguaagu  au u
-cacau  aac                  ----a           ua  a
Get sequence
Deep sequencing
4764 reads, 41 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 3' end of the miRNA is offset with respect to previous annotations. miR-652 cloned in [2] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 109298557-109298654 [+]
sense
OTTHUMT00000057896 ; TMEM164-001; intron 2
OTTHUMT00000057898 ; TMEM164-003; intron 2
OTTHUMT00000057899 ; TMEM164-004; intron 2
OTTHUMT00000057896 ; TMEM164-001; intron 2
OTTHUMT00000057898 ; TMEM164-003; intron 2
OTTHUMT00000057899 ; TMEM164-004; intron 2
OTTHUMT00000057896 ; TMEM164-001; intron 2
OTTHUMT00000057898 ; TMEM164-003; intron 2
OTTHUMT00000057899 ; TMEM164-004; intron 2
ENST00000372072 ; TMEM164-202; intron 1
ENST00000372072 ; TMEM164-202; intron 1
ENST00000372072 ; TMEM164-202; intron 1
ENST00000471255 ; TMEM164-004; intron 2
ENST00000372073 ; TMEM164-003; intron 2
ENST00000288381 ; TMEM164-001; intron 2
ENST00000372068 ; TMEM164-201; intron 2
ENST00000501872 ; TMEM164-203; intron 2
ENST00000471255 ; TMEM164-004; intron 2
ENST00000372073 ; TMEM164-003; intron 2
ENST00000288381 ; TMEM164-001; intron 2
ENST00000372068 ; TMEM164-201; intron 2
ENST00000501872 ; TMEM164-203; intron 2
ENST00000471255 ; TMEM164-004; intron 2
ENST00000372073 ; TMEM164-003; intron 2
ENST00000288381 ; TMEM164-001; intron 2
ENST00000372068 ; TMEM164-201; intron 2
Database links

Mature sequence hsa-miR-652-5p

Accession MIMAT0022709
Sequence

21 -  

caacccuaggagagggugccauuca

 - 45

Get sequence
Deep sequencing 88 reads, 11 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-652-3p

Accession MIMAT0003322
Previous IDs hsa-miR-652
Sequence

61 -  

aauggcgccacuaggguugug

 - 81

Get sequence
Deep sequencing 4676 reads, 40 experiments
Evidence experimental; Microarray [1], SAGE [1], cloned [2]
Validated targets
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).