Stem-loop sequence hsa-mir-651

AccessionMI0003666 (change log)
Symbol HGNC:MIR651
DescriptionHomo sapiens miR-651 stem-loop
Gene family MIPF0000478; mir-651
Literature search

3 open access papers mention hsa-mir-651
(3 sentences)

Stem-loop
   ---------aau  a   c              a    ga       ucaaa 
5'             cu uca ugcuuuuuaggaua gcuu  cuuuugu     u
               || ||| |||||||||||||| ||||  |||||||      
3'             ga agu acggaaaauccuau ugaa  gaaaacg     a
   uuuguguaauuu  c   a              g    ag       uaaaa 
Get sequence
Deep sequencing
8136 reads, 7.38 reads per million, 149 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 8126965-8127061 [+]
intergenic
Database links

Mature sequence hsa-miR-651-5p

Accession MIMAT0003321
Sequence

16 - 

uuuaggauaagcuugacuuuug

 - 37

Get sequence
Deep sequencing8027 reads, 147 experiments
Evidence experimental; RT-PCR [1], SAGE [1], cloned [2], Illumina [3]
Database links
Predicted targets

Mature sequence hsa-miR-651-3p

Accession MIMAT0026624
Sequence

54 - 

aaaggaaaguguauccuaaaag

 - 75

Get sequence
Deep sequencing107 reads, 39 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).