Stem-loop sequence hsa-mir-650

AccessionMI0003665 (change log)
Symbol HGNC:MIR650
DescriptionHomo sapiens miR-650 stem-loop
Gene family MIPF0000457; mir-650
Literature search

24 open access papers mention hsa-mir-650
(199 sentences)

Stem-loop
   -----ca     ----------     cuc      c    -cu      a   ca 
5'        gugcu          ggggu   aggagg agcg   cucagg cgu  c
          |||||          |||||   |||||| ||||   |||||| |||  c
3'        cacgg          uccca   uccucc ucgu   gggucc gua  a
   uagugga     gacucacucc     --c      -    cuc      g   cc 
Get sequence
Deep sequencing
133 reads, 0 reads per million, 42 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 22822776-22822871 [+]
intergenic
Database links

Mature sequence hsa-miR-650

Accession MIMAT0003320
Sequence

16 - 

aggaggcagcgcucucaggac

 - 36

Get sequence
Deep sequencing18 reads, 8 experiments
Evidence experimental; Microarray [1], RT-PCR [1], SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).