Stem-loop sequence hsa-mir-641

AccessionMI0003656 (change log)
Symbol HGNC:MIR641
DescriptionHomo sapiens miR-641 stem-loop
Gene family MIPF0000679; mir-641
Literature search

10 open access papers mention hsa-mir-641
(32 sentences)

Stem-loop
   -u      a                    ag            ccucu u 
5'   ggguga aggaaggaaagacauaggau  agucaccucugu     g c
     |||||| ||||||||||||||||||||  ||||||||||||     |  
3'   cccauu uccuuccuuucuguauccug  ucaguggagaua     c c
   uc      c                    --            uccau u 
Get sequence
Deep sequencing
6653 reads, 4.14 reads per million, 145 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 40282543-40282641 [-]
intergenic
Database links

Mature sequence hsa-miR-641

Accession MIMAT0003311
Sequence

16 - 

aaagacauaggauagagucaccuc

 - 39

Get sequence
Deep sequencing6188 reads, 138 experiments
Evidence experimental; SAGE [1]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).