Stem-loop sequence hsa-mir-640

AccessionMI0003655 (change log)
Symbol HGNC:MIR640
DescriptionHomo sapiens miR-640 stem-loop
Gene family MIPF0000494; mir-640
Literature search

8 open access papers mention hsa-mir-640
(20 sentences)

Stem-loop
   ------- ug   --cu     a       aa     gaca   ----     c 
5'        g  acc    gggca guuccug  gauca    cau    cagau c
          |  |||    ||||| |||||||  |||||    |||    ||||| c
3'        c  ugg    uccgu caaggac  cuagu    gua    gucua u
   gggguuc gu   cauc     c       --     acgg   aaau     u 
Get sequence
Deep sequencing
44 reads, 36 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 19435063-19435158 [+]
sense
OTTHUMT00000316748 ; MAU2-001; intron 1
OTTHUMT00000471447 ; MAU2-008; intron 1
OTTHUMT00000459457 ; MAU2-006; intron 1
ENST00000392313 ; MAU2-001; intron 1
ENST00000609122 ; MAU2-008; intron 1
ENST00000586189 ; MAU2-006; intron 1
ENST00000262815 ; MAU2-201; intron 1
Database links

Mature sequence hsa-miR-640

Accession MIMAT0003310
Sequence

61 - 

augauccaggaaccugccucu

 - 81

Get sequence
Evidence experimental; RT-PCR [1], SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).