Stem-loop sequence hsa-mir-639

AccessionMI0003654
Symbol HGNC:MIR639
DescriptionHomo sapiens miR-639 stem-loop
Gene family MIPF0000549; mir-639
Stem-loop
   ------u   - gac g     g       ugga g    --    -      ag 
5'        ggc c   g ggcgc cgcggcc    g ggcg  gggc ggacgc  a
          ||| |   | ||||| |||||||    | ||||  |||| ||||||   
3'        ccg g   u ucgcg gcguugg    c ucgc  ucug uuugcg  g
   gucgugu   a gga g     a       ---- g    ua    a      cc 
Get sequence
Deep sequencing
246 reads, 677 reads per million, 47 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr19: 14529543-14529640 [+]
antisense
OTTHUMT00000459900 ; DDX39A-020; intron 1
OTTHUMT00000459878 ; DDX39A-003; intron 1
OTTHUMT00000459880 ; DDX39A-001; intron 1
OTTHUMT00000459883 ; DDX39A-017; intron 1
OTTHUMT00000459884 ; DDX39A-012; intron 1
OTTHUMT00000459888 ; DDX39A-006; intron 1
OTTHUMT00000459889 ; DDX39A-002; intron 1
OTTHUMT00000459890 ; DDX39A-007; intron 1
OTTHUMT00000459891 ; DDX39A-010; intron 1
OTTHUMT00000459892 ; DDX39A-013; intron 1
OTTHUMT00000459893 ; DDX39A-011; intron 1
OTTHUMT00000459894 ; DDX39A-008; intron 1
OTTHUMT00000459895 ; DDX39A-009; intron 1
ENST00000324340 ; DDX39A-020; intron 1
ENST00000589318 ; DDX39A-003; intron 1
ENST00000242776 ; DDX39A-001; intron 1
ENST00000588542 ; DDX39A-017; intron 1
ENST00000589675 ; DDX39A-012; intron 1
ENST00000590260 ; DDX39A-006; intron 1
ENST00000586558 ; DDX39A-002; intron 1
ENST00000590239 ; DDX39A-007; intron 1
ENST00000586993 ; DDX39A-010; intron 1
ENST00000592632 ; DDX39A-013; intron 1
ENST00000593008 ; DDX39A-011; intron 1
ENST00000591275 ; DDX39A-008; intron 1
ENST00000590696 ; DDX39A-009; intron 1
Database links

Mature sequence hsa-miR-639

Accession MIMAT0003309
Sequence

61 - 

aucgcugcgguugcgagcgcugu

 - 83

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; SAGE [1]
Validated targets
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).