Stem-loop sequence hsa-mir-638

AccessionMI0003653 (change log)
Symbol HGNC:MIR638
DescriptionHomo sapiens miR-638 stem-loop
Gene family MIPF0000486; mir-638
Literature search

57 open access papers mention hsa-mir-638
(666 sentences)

Stem-loop
   gugagcg     g    gg u   g     -  --    -   ----ua  -g   g 
5'        ggcgc gcag  a cgc ggcgg gu  ggcg gcc      gg  cgc g
          ||||| ||||  | ||| ||||| ||  |||| |||      ||  ||| a
3'        ucgcg cguc  u gcg ccgcc cg  ccgc cgg      cc  gcg g
   -------     g    aa -   g     g  ug    g   uaaggg  ag   g 
Get sequence
Deep sequencing
18 reads, 9.09 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 10718404-10718503 [+]
sense
OTTHUMT00000452042 ; SLC44A2-008; intron 1
OTTHUMT00000452043 ; SLC44A2-001; intron 1
OTTHUMT00000452044 ; SLC44A2-002; intron 1
ENST00000590382 ; SLC44A2-008; intron 1
ENST00000588465 ; SLC44A2-001; intron 1
ENST00000407327 ; SLC44A2-002; intron 1
Database links

Mature sequence hsa-miR-638

Accession MIMAT0003308
Sequence

16 - 

agggaucgcgggcggguggcggccu

 - 40

Get sequence
Deep sequencing8 reads, 8 experiments
Evidence experimental; Microarray [1], SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).