Stem-loop sequence hsa-mir-636

Accession MI0003651
Symbol HGNC:MIR636
Description Homo sapiens miR-636 stem-loop
Gene family MIPF0000524; mir-636
Stem-loop 
--ug  g       cggga  gc           c   -cc   u  cu  aa 
    gc gccuggg     gc  gcgggcggggc ggc   cgc gc  gg  u
    || |||||||     ||  ||||||||||| |||   ||| ||  ||   
    cg cggaucc     cg  cgcccgcccug ucg   gug cg  cc  u
gcug  g       -----  -a           c   uuc   u  cc  aa
Get sequence
Deep sequencing
101 reads, 22 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 74732532-74732630 [-]
sense
OTTHUMT00000439590 ; SRSF2-006; exon 1
OTTHUMT00000439592 ; SRSF2-008; intron 1
OTTHUMT00000439593 ; SRSF2-007; intron 1
OTTHUMT00000437489 ; SRSF2-003; exon 2
OTTHUMT00000437490 ; SRSF2-001; exon 2
OTTHUMT00000437491 ; SRSF2-004; exon 2
OTTHUMT00000439591 ; SRSF2-005; exon 2
OTTHUMT00000437492 ; SRSF2-002; exon 2
ENST00000452355 ; SRSF2-204; intron 1
ENST00000452355 ; SRSF2-204; intron 1
ENST00000582449 ; SRSF2-006; exon 1
ENST00000583836 ; SRSF2-008; intron 1
ENST00000358156 ; SRSF2-007; intron 1
ENST00000392485 ; SRSF2-203; exon 2
ENST00000508921 ; SRSF2-205; exon 2
ENST00000392485 ; SRSF2-003; exon 2
ENST00000359995 ; SRSF2-001; exon 2
ENST00000585202 ; SRSF2-004; exon 2
ENST00000452355 ; SRSF2-005; exon 2
ENST00000508921 ; SRSF2-002; exon 2
ENST00000359995 ; SRSF2-202; exon 3
ENST00000358156 ; SRSF2-201; exon 3
Database links

Mature sequence hsa-miR-636

Accession MIMAT0003306
Sequence

61 -  

ugugcuugcucgucccgcccgca

 - 83

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; SAGE [1], cloned [2]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).