Stem-loop sequence hsa-mir-636

AccessionMI0003651 (change log)
Symbol HGNC:MIR636
DescriptionHomo sapiens miR-636 stem-loop
Gene family MIPF0000524; mir-636
Literature search

11 open access papers mention hsa-mir-636
(33 sentences)

Stem-loop
   --ug  g       cggga  gc           c   -cc   u  cu  aa 
5'     gc gccuggg     gc  gcgggcggggc ggc   cgc gc  gg  u
       || |||||||     ||  ||||||||||| |||   ||| ||  ||   
3'     cg cggaucc     cg  cgcccgcccug ucg   gug cg  cc  u
   gcug  g       -----  -a           c   uuc   u  cc  aa 
Get sequence
Deep sequencing
745 reads, 37.1 reads per million, 97 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 76736450-76736548 [-]
sense
OTTHUMT00000317100 ; CYTH1-002; intron 1
OTTHUMT00000317099 ; CYTH1-001; intron 1
OTTHUMT00000317110 ; CYTH1-012; intron 1
OTTHUMT00000317107 ; CYTH1-009; intron 1
OTTHUMT00000317111 ; CYTH1-013; intron 1
ENST00000591455 ; CYTH1-002; intron 1
ENST00000446868 ; CYTH1-001; intron 1
ENST00000589296 ; CYTH1-012; intron 1
ENST00000591574 ; CYTH1-009; intron 1
ENST00000592497 ; CYTH1-013; intron 1
ENST00000361101 ; CYTH1-201; intron 1
Database links

Mature sequence hsa-miR-636

Accession MIMAT0003306
Sequence

61 - 

ugugcuugcucgucccgcccgca

 - 83

Get sequence
Deep sequencing113 reads, 40 experiments
Evidence experimental; SAGE [1], cloned [2]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).