Stem-loop sequence hsa-mir-635

AccessionMI0003650 (change log)
Symbol HGNC:MIR635
DescriptionHomo sapiens miR-635 stem-loop
Gene family MIPF0000662; mir-635
Stem-loop
   caga a      gc  cu       u         ucc      cuuu   a 
5'     g ggagcu  ca  ugggcac gaaacaaug   auuagg    guu u
       | ||||||  ||  ||||||| |||||||||   ||||||    ||| g
3'     c cuucga  gu  accugug uuuuguuac   uagucc    caa g
   -uaa -      --  -u       -         ---      ucuu   a 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 68424451-68424548 [-]
intergenic
Database links

Mature sequence hsa-miR-635

Accession MIMAT0003305
Sequence

16 - 

acuugggcacugaaacaaugucc

 - 38

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).