Stem-loop sequence hsa-mir-634

AccessionMI0003649 (change log)
Symbol HGNC:MIR634
DescriptionHomo sapiens miR-634 stem-loop
Gene family MIPF0000600; mir-634
Literature search

9 open access papers mention hsa-mir-634
(79 sentences)

Stem-loop
   aaacccacacc    c    ug  ca  g          -c     -   a    
5'            acug auuu  gc  uc aggguugggg  uuggu guc ugc 
              |||| ||||  ||  || ||||||||||  ||||| ||| || c
3'            ugau uagg  cg  ag uuucaacccc  gacca uag acc 
   ---------uc    -    ua  ac  g          ac     a   a    
Get sequence
Deep sequencing
11 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 66787072-66787168 [+]
intergenic
Database links

Mature sequence hsa-miR-634

Accession MIMAT0003304
Sequence

61 - 

aaccagcaccccaacuuuggac

 - 82

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).