Stem-loop sequence hsa-mir-33b

Accession MI0003646
Symbol HGNC:MIR33B
Description Homo sapiens miR-33b stem-loop
Gene family MIPF0000070; mir-33
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-33. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-33 is a family of microRNA precursors, which are processed by the Dicer enzyme to give mature microRNAs. miR-33 is found in several animal species, including humans. In some species there is a single member of this family which gives the mature product mir-33. In humans there are two members of this family called mir-33a and mir-33b, which are located in intronic regions within two protein-coding genes for Sterol regulatory element-binding proteins (SREBP-2 and SREBP-1) respectively.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -----  ---    -   c   c  -          uu         g   g 
5'      gc   gggc ggc ccg gg ugcauugcug  gcauugcac ugu u
        ||   |||| ||| ||| || ||||||||||  ||||||||| ||| g
3'      cg   cccg ccg ggc cc acgugacggc  cgugacgug gcg a
   cacca  guc    g   a   -  g          uc         g   g 
Get sequence
Deep sequencing
626 reads, 269 reads per million, 52 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr17: 17813836-17813931 [-]
sense
OTTHUMT00000131929 ; TOM1L2-002; intron 1
OTTHUMT00000131928 ; TOM1L2-001; intron 1
OTTHUMT00000443246 ; TOM1L2-010; intron 1
OTTHUMT00000131931 ; TOM1L2-004; intron 1
OTTHUMT00000443248 ; TOM1L2-007; intron 1
OTTHUMT00000443249 ; TOM1L2-009; intron 1
OTTHUMT00000443250 ; TOM1L2-008; intron 1
OTTHUMT00000443252 ; TOM1L2-011; intron 1
OTTHUMT00000443253 ; TOM1L2-012; intron 1
ENST00000581396 ; TOM1L2-002; intron 1
ENST00000379504 ; TOM1L2-001; intron 1
ENST00000318094 ; TOM1L2-010; intron 1
ENST00000395739 ; TOM1L2-004; intron 1
ENST00000535933 ; TOM1L2-007; intron 1
ENST00000540946 ; TOM1L2-009; intron 1
ENST00000542206 ; TOM1L2-008; intron 1
ENST00000537091 ; TOM1L2-011; intron 1
ENST00000579586 ; TOM1L2-012; intron 1
Clustered miRNAs
< 10kb from hsa-mir-33b
hsa-mir-33b chr17: 17813836-17813931 [-]
hsa-mir-6777 chr17: 17813480-17813545 [-]
Database links

Mature sequence hsa-miR-33b-5p

Accession MIMAT0003301
Previous IDs hsa-miR-33b
Sequence

16 - 

gugcauugcuguugcauugc

 - 35

Get sequence
Deep sequencing 203 reads, 34 experiments
Evidence experimental; SAGE [1], cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-33b-3p

Accession MIMAT0004811
Previous IDs hsa-miR-33b*
Sequence

54 - 

cagugccucggcagugcagccc

 - 75

Get sequence
Deep sequencing 33 reads, 13 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).