Stem-loop sequence hsa-mir-33b

Accession MI0003646
Symbol HGNC:MIR33B
Description Homo sapiens miR-33b stem-loop
Gene family MIPF0000070; mir-33
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-33. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-33 is a family of microRNA precursors, which are processed by the Dicer enzyme to give mature microRNAs. miR-33 is found in several animal species, including humans. In some species there is a single member of this family which gives the mature product mir-33. In humans there are two members of this family called mir-33a and mir-33b, which are located in intronic regions within two protein-coding genes for Sterol regulatory element-binding proteins (SREBP-2 and SREBP-1) respectively.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-----  ---    -   c   c  -          uu         g   g 
     gc   gggc ggc ccg gg ugcauugcug  gcauugcac ugu u
     ||   |||| ||| ||| || ||||||||||  ||||||||| ||| g
     cg   cccg ccg ggc cc acgugacggc  cgugacgug gcg a
cacca  guc    g   a   -  g          uc         g   g 
Get sequence
Deep sequencing
391 reads, 23 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 17717150-17717245 [-]
sense
OTTHUMT00000131905 ; SREBF1-014; intron 1
OTTHUMT00000131906 ; SREBF1-015; intron 1
OTTHUMT00000131905 ; SREBF1-014; intron 1
OTTHUMT00000131906 ; SREBF1-015; intron 1
OTTHUMT00000131905 ; SREBF1-014; intron 1
OTTHUMT00000131906 ; SREBF1-015; intron 1
OTTHUMT00000131774 ; SREBF1-005; intron 11
OTTHUMT00000131774 ; SREBF1-005; intron 11
OTTHUMT00000131774 ; SREBF1-005; intron 11
OTTHUMT00000131773 ; SREBF1-004; intron 14
OTTHUMT00000131773 ; SREBF1-004; intron 14
OTTHUMT00000131773 ; SREBF1-004; intron 14
OTTHUMT00000442886 ; SREBF1-018; intron 15
OTTHUMT00000131771 ; SREBF1-002; intron 16
OTTHUMT00000131772 ; SREBF1-003; intron 16
OTTHUMT00000131771 ; SREBF1-002; intron 16
OTTHUMT00000131772 ; SREBF1-003; intron 16
OTTHUMT00000131771 ; SREBF1-002; intron 16
OTTHUMT00000131770 ; SREBF1-001; intron 17
OTTHUMT00000131770 ; SREBF1-001; intron 17
OTTHUMT00000131772 ; SREBF1-003; intron 17
ENST00000486311 ; SREBF1-014; intron 1
ENST00000478616 ; SREBF1-015; intron 1
ENST00000486311 ; SREBF1-014; intron 1
ENST00000478616 ; SREBF1-015; intron 1
ENST00000486311 ; SREBF1-014; intron 1
ENST00000478616 ; SREBF1-015; intron 1
ENST00000395756 ; SREBF1-005; intron 11
ENST00000395756 ; SREBF1-005; intron 11
ENST00000395756 ; SREBF1-005; intron 11
ENST00000395757 ; SREBF1-004; intron 14
ENST00000395757 ; SREBF1-004; intron 14
ENST00000395757 ; SREBF1-004; intron 14
ENST00000418712 ; SREBF1-202; intron 15
ENST00000418712 ; SREBF1-202; intron 15
ENST00000395751 ; SREBF1-018; intron 15
ENST00000261646 ; SREBF1-002; intron 16
ENST00000395751 ; SREBF1-003; intron 16
ENST00000338854 ; SREBF1-201; intron 16
ENST00000261646 ; SREBF1-002; intron 16
ENST00000395751 ; SREBF1-003; intron 16
ENST00000338854 ; SREBF1-201; intron 16
ENST00000261646 ; SREBF1-002; intron 16
ENST00000338854 ; SREBF1-201; intron 16
ENST00000355815 ; SREBF1-001; intron 17
ENST00000423161 ; SREBF1-203; intron 17
ENST00000355815 ; SREBF1-001; intron 17
ENST00000423161 ; SREBF1-203; intron 17
ENST00000355815 ; SREBF1-003; intron 17
Database links

Mature sequence hsa-miR-33b-5p

Accession MIMAT0003301
Previous IDs hsa-miR-33b
Sequence

16 - 

gugcauugcuguugcauugc

 - 35

Get sequence
Deep sequencing 348 reads, 21 experiments
Evidence experimental; SAGE [1], cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-33b-3p

Accession MIMAT0004811
Previous IDs hsa-miR-33b*
Sequence

54 - 

cagugccucggcagugcagccc

 - 75

Get sequence
Deep sequencing 23 reads, 9 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).