Stem-loop sequence hsa-mir-33b

AccessionMI0003646 (change log)
Symbol HGNC:MIR33B
DescriptionHomo sapiens miR-33b stem-loop
Gene family MIPF0000070; mir-33
Literature search

121 open access papers mention hsa-mir-33b
(1276 sentences)

Stem-loop
   -----  ---    -   c   c  -          uu         g   g 
5'      gc   gggc ggc ccg gg ugcauugcug  gcauugcac ugu u
        ||   |||| ||| ||| || ||||||||||  ||||||||| ||| g
3'      cg   cccg ccg ggc cc acgugacggc  cgugacgug gcg a
   cacca  guc    g   a   -  g          uc         g   g 
Get sequence
Deep sequencing
11166 reads, 27.3 reads per million, 150 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 17813836-17813931 [-]
sense
OTTHUMT00000131929 ; TOM1L2-002; intron 1
OTTHUMT00000131928 ; TOM1L2-001; intron 1
OTTHUMT00000443246 ; TOM1L2-010; intron 1
OTTHUMT00000131931 ; TOM1L2-004; intron 1
OTTHUMT00000443248 ; TOM1L2-007; intron 1
OTTHUMT00000443249 ; TOM1L2-009; intron 1
OTTHUMT00000443250 ; TOM1L2-008; intron 1
OTTHUMT00000443252 ; TOM1L2-011; intron 1
OTTHUMT00000443253 ; TOM1L2-012; intron 1
ENST00000581396 ; TOM1L2-002; intron 1
ENST00000379504 ; TOM1L2-001; intron 1
ENST00000318094 ; TOM1L2-010; intron 1
ENST00000395739 ; TOM1L2-004; intron 1
ENST00000535933 ; TOM1L2-007; intron 1
ENST00000540946 ; TOM1L2-009; intron 1
ENST00000542206 ; TOM1L2-008; intron 1
ENST00000537091 ; TOM1L2-011; intron 1
ENST00000579586 ; TOM1L2-012; intron 1
Clustered miRNAs
< 10kb from hsa-mir-33b
hsa-mir-33bchr17: 17813836-17813931 [-]
hsa-mir-6777chr17: 17813480-17813545 [-]
Database links

Mature sequence hsa-miR-33b-5p

Accession MIMAT0003301
Previous IDshsa-miR-33b
Sequence

16 - 

gugcauugcuguugcauugc

 - 35

Get sequence
Deep sequencing9770 reads, 142 experiments
Evidence experimental; SAGE [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-33b-3p

Accession MIMAT0004811
Previous IDshsa-miR-33b*
Sequence

54 - 

cagugccucggcagugcagccc

 - 75

Get sequence
Deep sequencing1236 reads, 88 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).