Stem-loop sequence hsa-mir-630

AccessionMI0003644 (change log)
Symbol HGNC:MIR630
DescriptionHomo sapiens miR-630 stem-loop
Gene family MIPF0000653; mir-630
Literature search

44 open access papers mention hsa-mir-630
(463 sentences)

Stem-loop
   aacuuaacaucau       -     -   --c     uu         g 
5'              gcuaccu cuuug uau   auauu  guuauucug u
                ||||||| ||||| |||   |||||  |||||||||  
3'              ugaugga gggac aug   uauga  caguaagac c
   -uauaucaauucu       a     c   ucu     uc         a 
Get sequence
Deep sequencing
23792 reads, 3.44e+03 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 72587217-72587313 [+]
sense
OTTHUMT00000435738 ; RP11-106M3.3-001; intron 1
ENST00000570175 ; RP11-106M3.3-001; intron 1
antisense
OTTHUMT00000420182 ; CELF6-008; intron 2
OTTHUMT00000420183 ; CELF6-003; intron 2
OTTHUMT00000420185 ; CELF6-004; intron 2
OTTHUMT00000420180 ; RP11-106M3.5-001; intron 3
OTTHUMT00000257316 ; CELF6-001; intron 3
OTTHUMT00000420184 ; CELF6-002; intron 3
OTTHUMT00000420186 ; RP11-106M3.2-001; intron 8
ENST00000437872 ; CELF6-008; intron 2
ENST00000543764 ; CELF6-003; intron 2
ENST00000569311 ; CELF6-004; intron 2
ENST00000539635 ; CELF6-202; intron 2
ENST00000569547 ; CELF6-001; intron 3
ENST00000287202 ; CELF6-001; intron 3
ENST00000567083 ; CELF6-002; intron 3
ENST00000379915 ; RP11-106M3.2-001; intron 8
Database links

Mature sequence hsa-miR-630

Accession MIMAT0003299
Sequence

61 - 

aguauucuguaccagggaaggu

 - 82

Get sequence
Deep sequencing23770 reads, 21 experiments
Evidence experimental; RT-PCR [1], SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).