Stem-loop sequence hsa-mir-630

AccessionMI0003644
Symbol HGNC:MIR630
DescriptionHomo sapiens miR-630 stem-loop
Gene family MIPF0000653; mir-630
Stem-loop
   aacuuaacaucau       -     -   --c     uu         g 
5'              gcuaccu cuuug uau   auauu  guuauucug u
                ||||||| ||||| |||   |||||  |||||||||  
3'              ugaugga gggac aug   uauga  caguaagac c
   -uauaucaauucu       a     c   ucu     uc         a 
Get sequence
Deep sequencing
1 reads, 0.222 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr15: 72587217-72587313 [+]
sense
OTTHUMT00000435738 ; RP11-106M3.3-001; intron 1
ENST00000570175 ; RP11-106M3.3-001; intron 1
antisense
OTTHUMT00000420182 ; CELF6-008; intron 2
OTTHUMT00000420183 ; CELF6-003; intron 2
OTTHUMT00000420185 ; CELF6-004; intron 2
OTTHUMT00000420180 ; RP11-106M3.5-001; intron 3
OTTHUMT00000257316 ; CELF6-001; intron 3
OTTHUMT00000420184 ; CELF6-002; intron 3
OTTHUMT00000420186 ; RP11-106M3.2-001; intron 8
ENST00000437872 ; CELF6-008; intron 2
ENST00000543764 ; CELF6-003; intron 2
ENST00000569311 ; CELF6-004; intron 2
ENST00000539635 ; CELF6-202; intron 2
ENST00000569547 ; CELF6-001; intron 3
ENST00000287202 ; CELF6-001; intron 3
ENST00000567083 ; CELF6-002; intron 3
ENST00000379915 ; RP11-106M3.2-001; intron 8
Database links

Mature sequence hsa-miR-630

Accession MIMAT0003299
Sequence

61 - 

aguauucuguaccagggaaggu

 - 82

Get sequence
Evidence experimental; RT-PCR [1], SAGE [1]
Validated targets
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).