Stem-loop sequence hsa-mir-629

AccessionMI0003643 (change log)
Symbol HGNC:MIR629
DescriptionHomo sapiens miR-629 stem-loop
Gene family MIPF0001555; mir-629
Literature search

27 open access papers mention hsa-mir-629
(101 sentences)

Stem-loop
   ucccuuuccc                                   ac  u 
5'           aggggaggggcuggguuuacguugggagaacuuuu  gg g
             |||||||||||||||||||||||||||||||||||  ||  
3'           uccccuccccgacccgaaugcaacccucuuggagg  cc a
   ----uccguc                                   -a  a 
Get sequence
Deep sequencing
44631 reads, 99.4 reads per million, 157 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 70079372-70079468 [-]
intergenic
Database links

Mature sequence hsa-miR-629-5p

Accession MIMAT0004810
Previous IDshsa-miR-629
Sequence

22 - 

uggguuuacguugggagaacu

 - 42

Get sequence
Deep sequencing40161 reads, 153 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-629-3p

Accession MIMAT0003298
Previous IDshsa-miR-629;hsa-miR-629*
Sequence

61 - 

guucucccaacguaagcccagc

 - 82

Get sequence
Deep sequencing4415 reads, 138 experiments
Evidence experimental; SAGE [1], cloned [2]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).