Stem-loop sequence hsa-mir-628

AccessionMI0003642 (change log)
Symbol HGNC:MIR628
DescriptionHomo sapiens miR-628 stem-loop
Gene family MIPF0000529; mir-628
Literature search

32 open access papers mention hsa-mir-628
(78 sentences)

Stem-loop
   auagcugu  u   a      ca  -   a   a             aaaa 
5'         ug guc cuuccu  ug cug cau uuuacuagagggu    u
           || ||| ||||||  || ||| ||| |||||||||||||     
3'         ac cgg gaaggg  gc gac gug gaaugaucuucca    u
   -------u  u   -      aa  u   g   a             auaa 
Get sequence
Deep sequencing
13692 reads, 4.11 reads per million, 146 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 55372940-55373034 [-]
antisense
OTTHUMT00000419665 ; RP11-548M13.1-001; intron 1
ENST00000569661 ; RP11-548M13.1-001; intron 1
Database links

Mature sequence hsa-miR-628-5p

Accession MIMAT0004809
Sequence

23 - 

augcugacauauuuacuagagg

 - 44

Get sequence
Deep sequencing11653 reads, 146 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-628-3p

Accession MIMAT0003297
Previous IDshsa-miR-628
Sequence

61 - 

ucuaguaagaguggcagucga

 - 81

Get sequence
Deep sequencing2008 reads, 87 experiments
Evidence experimental; Microarray [1], RT-PCR [1], SAGE [1], cloned [2]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).