Stem-loop sequence hsa-mir-627

AccessionMI0003641 (change log)
Symbol HGNC:MIR627
DescriptionHomo sapiens miR-627 stem-loop
Gene family MIPF0000550; mir-627
Literature search

10 open access papers mention hsa-mir-627
(15 sentences)

Stem-loop
   ---------ua       c              u              ug u 
5'            cuuauua ugguagugagucuc aagaaaagaggagg  g u
              ||||||| |||||||||||||| ||||||||||||||  |  
3'            gaauaau accaucacucagag uucuuuucuccucc  u g
   aucaucauaaa       a              u              uu u 
Get sequence
Deep sequencing
4785 reads, 3.42 reads per million, 146 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 42199570-42199666 [-]
sense
OTTHUMT00000252737 ; EHD4-001; intron 5
ENST00000220325 ; EHD4-001; intron 5
Database links

Mature sequence hsa-miR-627-5p

Accession MIMAT0003296
Sequence

16 - 

gugagucucuaagaaaagagga

 - 37

Get sequence
Deep sequencing4215 reads, 136 experiments
Evidence experimental; SAGE [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-627-3p

Accession MIMAT0026623
Sequence

55 - 

ucuuuucuuugagacucacu

 - 74

Get sequence
Deep sequencing557 reads, 115 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).