|
miRBase |
|
Stem-loop sequence hsa-mir-625 |
|||||
| Accession | MI0003639 | ||||
| Symbol | HGNC:MIR625 | ||||
| Description | Homo sapiens miR-625 stem-loop | ||||
| Gene family | MIPF0000534; mir-625 | ||||
| Stem-loop |
uaau aggguagagggaugagggggaaaguucuauaguccug u ||||||||||||||||||||||||||||||||||||| a ucccgucucccuacucccccuuucaagauaucaggac g ucua |
||||
| Deep sequencing |
| ||||
| Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-625-5p |
|
| Accession | MIMAT0003294 |
| Previous IDs | hsa-miR-625 |
| Sequence |
15 - agggggaaaguucuauagucc - 35 |
| Deep sequencing | 213 reads, 15 experiments |
| Evidence | experimental; Microarray [1], RT-PCR [1], SAGE [1], cloned [2] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence hsa-miR-625-3p |
|
| Accession | MIMAT0004808 |
| Previous IDs | hsa-miR-625* |
| Sequence |
52 - gacuauagaacuuucccccuca - 73 |
| Deep sequencing | 211 reads, 16 experiments |
| Evidence | experimental; cloned [2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16505370
"The colorectal microRNAome"
Proc Natl Acad Sci U S A. 103:3687-3692(2006).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|