Stem-loop sequence hsa-mir-625

AccessionMI0003639 (change log)
Symbol HGNC:MIR625
DescriptionHomo sapiens miR-625 stem-loop
Gene family MIPF0000534; mir-625
Literature search

40 open access papers mention hsa-mir-625
(455 sentences)

5' aggguagagggaugagggggaaaguucuauaguccug    u
   |||||||||||||||||||||||||||||||||||||    a
3' ucccgucucccuacucccccuuucaagauaucaggac    g
Get sequence
Deep sequencing
19204 reads, 24.4 reads per million, 156 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 65471102-65471186 [+]
OTTHUMT00000414296 ; CHURC1-FNTB-004; intron 2
OTTHUMT00000286392 ; FNTB-001; intron 2
OTTHUMT00000414347 ; FNTB-006; intron 2
OTTHUMT00000414323 ; FNTB-003; intron 2
OTTHUMT00000408067 ; CHURC1-FNTB-002; intron 3
OTTHUMT00000408068 ; CHURC1-FNTB-001; intron 4
OTTHUMT00000408069 ; CHURC1-FNTB-003; intron 4
ENST00000246166 ; FNTB-001; intron 2
ENST00000555372 ; FNTB-006; intron 2
ENST00000555742 ; FNTB-003; intron 2
ENST00000553743 ; CHURC1-FNTB-004; intron 2
ENST00000542227 ; FNTB-202; intron 3
ENST00000552941 ; CHURC1-FNTB-002; intron 3
ENST00000447296 ; FNTB-201; intron 4
ENST00000549987 ; CHURC1-FNTB-001; intron 4
ENST00000551823 ; CHURC1-FNTB-003; intron 4
Database links

Mature sequence hsa-miR-625-5p

Accession MIMAT0003294
Previous IDshsa-miR-625

15 - 


 - 35

Get sequence
Deep sequencing12247 reads, 153 experiments
Evidence experimental; Microarray [1], RT-PCR [1], SAGE [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-625-3p

Accession MIMAT0004808
Previous IDshsa-miR-625*

52 - 


 - 73

Get sequence
Deep sequencing6937 reads, 149 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets


PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).