Stem-loop sequence hsa-mir-625

AccessionMI0003639
Symbol HGNC:MIR625
DescriptionHomo sapiens miR-625 stem-loop
Gene family MIPF0000534; mir-625
Stem-loop
                                        uaau 
5' aggguagagggaugagggggaaaguucuauaguccug    u
   |||||||||||||||||||||||||||||||||||||    a
3' ucccgucucccuacucccccuuucaagauaucaggac    g
                                        ucua 
Get sequence
Deep sequencing
2967 reads, 416 reads per million, 59 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr14: 65471102-65471186 [+]
sense
OTTHUMT00000414296 ; CHURC1-FNTB-004; intron 2
OTTHUMT00000286392 ; FNTB-001; intron 2
OTTHUMT00000414347 ; FNTB-006; intron 2
OTTHUMT00000414323 ; FNTB-003; intron 2
OTTHUMT00000408067 ; CHURC1-FNTB-002; intron 3
OTTHUMT00000408068 ; CHURC1-FNTB-001; intron 4
OTTHUMT00000408069 ; CHURC1-FNTB-003; intron 4
ENST00000246166 ; FNTB-001; intron 2
ENST00000555372 ; FNTB-006; intron 2
ENST00000555742 ; FNTB-003; intron 2
ENST00000553743 ; CHURC1-FNTB-004; intron 2
ENST00000542227 ; FNTB-202; intron 3
ENST00000552941 ; CHURC1-FNTB-002; intron 3
ENST00000447296 ; FNTB-201; intron 4
ENST00000549987 ; CHURC1-FNTB-001; intron 4
ENST00000551823 ; CHURC1-FNTB-003; intron 4
Database links

Mature sequence hsa-miR-625-5p

Accession MIMAT0003294
Previous IDshsa-miR-625
Sequence

15 - 

agggggaaaguucuauagucc

 - 35

Get sequence
Deep sequencing1020 reads, 47 experiments
Evidence experimental; Microarray [1], RT-PCR [1], SAGE [1], cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-625-3p

Accession MIMAT0004808
Previous IDshsa-miR-625*
Sequence

52 - 

gacuauagaacuuucccccuca

 - 73

Get sequence
Deep sequencing773 reads, 36 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).