Stem-loop sequence hsa-mir-620

AccessionMI0003634 (change log)
Symbol HGNC:MIR620
DescriptionHomo sapiens miR-620 stem-loop
Literature search

3 open access papers mention hsa-mir-620
(5 sentences)

Stem-loop
   -----------aua   a          g            auau    aua 
5'               uau ucuauaucua cuccguauauau    auau   u
                 ||| |||||||||| ||||||||||||    ||||    
3'               aua agauauagau gagguauauaua    uaua   a
   aagaaacgaacaaa   a          a            ccuc    gau 
Get sequence
Deep sequencing
1135 reads, 20 reads per million, 45 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 116148560-116148654 [-]
intergenic
Database links

Mature sequence hsa-miR-620

Accession MIMAT0003289
Sequence

61 - 

auggagauagauauagaaau

 - 80

Get sequence
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).