Stem-loop sequence hsa-mir-619

AccessionMI0003633 (change log)
Symbol HGNC:MIR619
DescriptionHomo sapiens miR-619 stem-loop
Gene family MIPF0000557; mir-619
Literature search

6 open access papers mention hsa-mir-619
(83 sentences)

Stem-loop
   -c  cc  -cu   ccucccaaaa       au          ag   cugc    ga 
5'   gc  ac   cag          ugcuggg  uacaggcaug  cca    gguc  c
     ||  ||   |||          |||||||  ||||||||||  |||    ||||   
3'   cg  ug   guc          augaccc  guguuuguac  ggu    ccag  c
   ga  uu  acu   ----------       --          -a   ----    ua 
Get sequence
Deep sequencing
14235 reads, 201 reads per million, 169 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 108836908-108837006 [-]
sense
OTTHUMT00000404872 ; RP11-13G14.4-001; intron 15
ENST00000502160 ; RP11-13G14.4-001; intron 15
Database links

Mature sequence hsa-miR-619-5p

Accession MIMAT0026622
Sequence

24 - 

gcugggauuacaggcaugagcc

 - 45

Get sequence
Deep sequencing10985 reads, 161 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence hsa-miR-619-3p

Accession MIMAT0003288
Sequence

61 - 

gaccuggacauguuugugcccagu

 - 84

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).