Stem-loop sequence hsa-mir-618

AccessionMI0003632 (change log)
Symbol HGNC:MIR618
DescriptionHomo sapiens miR-618 stem-loop
Gene family MIPF0000553; mir-618
Literature search

8 open access papers mention hsa-mir-618
(9 sentences)

Stem-loop
   ---cu  ug       -cc    u  a      c        guaau   -  a 
5'      cu  uucacag   aaac cu cuuguc uucugagu     uac gu c
        ||  |||||||   |||| || |||||| ||||||||     ||| ||  
3'      ga  agguguc   uuug ga gaacag aggacucg     aug cg a
   agucu  gu       cca    -  c      -        -----   a  u 
Get sequence
Deep sequencing
4300 reads, 13.1 reads per million, 99 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 80935736-80935833 [-]
antisense
ENST00000266688 ; PTPRQ-201; intron 26
Database links

Mature sequence hsa-miR-618

Accession MIMAT0003287
Sequence

16 - 

aaacucuacuuguccuucugagu

 - 38

Get sequence
Deep sequencing4253 reads, 90 experiments
Evidence experimental; RT-PCR [1], SAGE [1], cloned [2]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).