Stem-loop sequence hsa-mir-548c

AccessionMI0003630 (change log)
Symbol HGNC:MIR548C
DescriptionHomo sapiens miR-548c stem-loop
Gene family MIPF0000317; mir-548
Stem-loop
   cauuggcauc                         c         cau   u 
5'           uauuagguuggugcaaaaguaauug gguuuuugc   uac u
             ||||||||||||||||||||||||| |||||||||   ||| u
3'           auaauucaaccacguuuucauuaac cuaaaaacg   aug c
   -------uuc                         u         ---   a 
Get sequence
Deep sequencing
12876 reads, 23.3 reads per million, 73 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Extensive cloning studies suggest that the 5' miRNA may be the predominant one [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 64622509-64622605 [+]
sense
OTTHUMT00000401052 ; RPS11P6-004; intron 2
ENST00000535684 ; RPS11P6-004; intron 2
Clustered miRNAs
< 10kb from hsa-mir-548c
hsa-mir-548cchr12: 64622509-64622605 [+]
hsa-mir-548zchr12: 64622509-64622605 [-]
Database links

Mature sequence hsa-miR-548c-5p

Accession MIMAT0004806
Sequence

25 - 

aaaaguaauugcgguuuuugcc

 - 46

Get sequence
Deep sequencing12220 reads, 72 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-548c-3p

Accession MIMAT0003285
Previous IDshsa-miR-548c
Sequence

61 - 

caaaaaucucaauuacuuuugc

 - 82

Get sequence
Deep sequencing239 reads, 34 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).