Stem-loop sequence hsa-mir-548c

Accession

MI0003630

Symbol

HGNC:MIR548C

Description

Homo sapiens miR-548c stem-loop

Gene family

MIPF0000317; mir-548

Stem-loop

cauuggcauc                         c         cau   u 
          uauuagguuggugcaaaaguaauug gguuuuugc   uac u
          ||||||||||||||||||||||||| |||||||||   ||| u
          auaauucaaccacguuuucauuaac cuaaaaacg   aug c
-------uuc                         u         ---   a 

Deep sequencing

87 reads, 16 experiments

Comments

Extensive cloning studies suggest that the 5' miRNA may be the predominant one [2].

Genome context

• Coordinates (GRCh37.p5): chr12: 65016289-65016385 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000401160 ; RASSF3-002; intron 1

  OTTHUMT00000401161 ; RASSF3-001; intron 1

  OTTHUMT00000401160 ; RASSF3-002; intron 1

  OTTHUMT00000401161 ; RASSF3-001; intron 1

  OTTHUMT00000401160 ; RASSF3-002; intron 1

  OTTHUMT00000401161 ; RASSF3-001; intron 1

  ENST00000283172 ; RASSF3-002; intron 1

  ENST00000542104 ; RASSF3-001; intron 1

  ENST00000541539 ; RASSF3-202; intron 1

  ENST00000283172 ; RASSF3-002; intron 1

  ENST00000542104 ; RASSF3-001; intron 1

  ENST00000541539 ; RASSF3-202; intron 1

  ENST00000283172 ; RASSF3-002; intron 1

  ENST00000542104 ; RASSF3-001; intron 1

  ENST00000336061 ; RASSF3-201; intron 2

  ENST00000336061 ; RASSF3-201; intron 2

  ENST00000336061 ; RASSF3-201; intron 2

Clustered miRNAs

< 10kb from hsa-mir-548c

• hsa-mir-548c: chr12: 65016289-65016385 [+]
• hsa-mir-548z: chr12: 65016289-65016385 [-]

Database links

• ENTREZGENE: 693129;MIR548C
• HGNC: 32800;MIR548C

Mature sequence hsa-miR-548c-5p

• Accession: MIMAT0004806
• Sequence: 25 - aaaaguaauugcgguuuuugcc - 46
• Deep sequencing: 84 reads, 15 experiments
• Evidence: experimental; cloned [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-548c-5p
  • MICRORNA.ORG:hsa-miR-548c-5p
  • MIRDB:hsa-miR-548c-5p
  • RNA22-HSA:hsa-miR-548c-5p
  • TARGETMINER:hsa-miR-548c-5p
  • TARGETSCAN-VERT:hsa-miR-548c-5p

Mature sequence hsa-miR-548c-3p

• Accession: MIMAT0003285
• Previous IDs: hsa-miR-548c
• Sequence: 61 - caaaaaucucaauuacuuuugc - 82
• Deep sequencing: 3 reads, 2 experiments
• Evidence: experimental; SAGE [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-548c-3p
  • MICRORNA.ORG:hsa-miR-548c-3p
  • MIRDB:hsa-miR-548c-3p
  • RNA22-HSA:hsa-miR-548c-3p
  • TARGETSCAN-VERT:hsa-miR-548c-3p

References

1. PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).