Stem-loop sequence hsa-mir-616

AccessionMI0003629
Symbol HGNC:MIR616
DescriptionHomo sapiens miR-616 stem-loop
Gene family MIPF0000507; mir-616
Stem-loop
   -------u     a       ca      a                -  gac 
5'         uaggu auuccuc  cucaaa cccuucagugacuucc au   a
           ||||| |||||||  |||||| |||||||||||||||| ||    
3'         gucca uaaggag  gaguuu gggagguuacugaagg ua   u
   aaaauuuu     g       ac      -                a  aag 
Get sequence
Deep sequencing
233 reads, 48.4 reads per million, 39 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr12: 57519163-57519259 [-]
sense
OTTHUMT00000412251 ; STAT6-002; intron 1
OTTHUMT00000412376 ; STAT6-010; intron 1
ENST00000556155 ; STAT6-002; intron 1
ENST00000553499 ; STAT6-010; intron 1
Clustered miRNAs
< 10kb from hsa-mir-616
hsa-mir-616chr12: 57519163-57519259 [-]
hsa-mir-6758chr12: 57512688-57512750 [+]
Database links

Mature sequence hsa-miR-616-5p

Accession MIMAT0003284
Previous IDshsa-miR-616;hsa-miR-616*
Sequence

16 - 

acucaaaacccuucagugacuu

 - 37

Get sequence
Deep sequencing39 reads, 17 experiments
Evidence experimental; SAGE [1]
Predicted targets

Mature sequence hsa-miR-616-3p

Accession MIMAT0004805
Previous IDshsa-miR-616
Sequence

56 - 

agucauuggaggguuugagcag

 - 77

Get sequence
Deep sequencing124 reads, 21 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).