|
miRBase |
|
Stem-loop sequence hsa-mir-615 |
|||||
| Accession | MI0003628 | ||||
| Symbol | HGNC:MIR615 | ||||
| Description | Homo sapiens miR-615 stem-loop | ||||
| Gene family | MIPF0000342; mir-615 | ||||
| Stem-loop |
cuc ag c -uc u cu g ug ggg ggg gggagggggg cccgg gcucggau cgag g c ||| ||| |||||||||| ||||| |||||||| |||| | u ccc ccc cccuucuccc ggguc cgagccug gcuu u u ccc aa - ucu - -- g ua |
||||
| Deep sequencing |
| ||||
| Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
||||
| Genome context |
|
||||
| Database links | |||||
Mature sequence hsa-miR-615-5p |
|
| Accession | MIMAT0004804 |
| Sequence |
18 - ggggguccccggugcucggauc - 39 |
| Deep sequencing | 133 reads, 14 experiments |
| Evidence | experimental; cloned [2] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence hsa-miR-615-3p |
|
| Accession | MIMAT0003283 |
| Previous IDs | hsa-miR-615 |
| Sequence |
61 - uccgagccugggucucccucuu - 82 |
| Deep sequencing | 347 reads, 27 experiments |
| Evidence | experimental; RT-PCR [1], SAGE [1], cloned [2] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:16505370
"The colorectal microRNAome"
Proc Natl Acad Sci U S A. 103:3687-3692(2006).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|