Stem-loop sequence hsa-mir-615

AccessionMI0003628
Symbol HGNC:MIR615
DescriptionHomo sapiens miR-615 stem-loop
Gene family MIPF0000342; mir-615
Stem-loop
   cuc   ag   c          -uc     u        cu    g ug 
5'    ggg  ggg gggagggggg   cccgg gcucggau  cgag g  c
      |||  ||| ||||||||||   ||||| ||||||||  |||| |  u
3'    ccc  ccc cccuucuccc   ggguc cgagccug  gcuu u  u
   ccc   aa   -          ucu     -        --    g ua 
Get sequence
Deep sequencing
851 reads, 656 reads per million, 67 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr12: 54033950-54034045 [+]
antisense
OTTHUMT00000407401 ; ATP5G2-009; intron 1
ENST00000550241 ; ATP5G2-009; intron 1
Database links

Mature sequence hsa-miR-615-5p

Accession MIMAT0004804
Sequence

18 - 

ggggguccccggugcucggauc

 - 39

Get sequence
Deep sequencing124 reads, 12 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-615-3p

Accession MIMAT0003283
Previous IDshsa-miR-615
Sequence

61 - 

uccgagccugggucucccucuu

 - 82

Get sequence
Deep sequencing278 reads, 39 experiments
Evidence experimental; RT-PCR [1], SAGE [1], cloned [2]
Validated targets
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).