Stem-loop sequence hsa-mir-614

AccessionMI0003627
Symbol HGNC:MIR614
DescriptionHomo sapiens miR-614 stem-loop
Gene family MIPF0000647; mir-614
Stem-loop
   ucuaagaaac     gg   -   aa     -           ---   cc 
5'           gcagu  ucu cug  gccug caggggcaggc   cag  c
             |||||  ||| |||  ||||| |||||||||||   |||  u
3'           cgucg  gga gac  uggac guucuuguccg   guc  g
   ----------     uu   a   gg     c           caa   ac 
Get sequence
Deep sequencing
2 reads, 21.3 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr12: 12915829-12915918 [+]
sense
OTTHUMT00000331627 ; APOLD1-001; intron 1
OTTHUMT00000453200 ; APOLD1-003; intron 1
OTTHUMT00000400668 ; APOLD1-004; intron 2
OTTHUMT00000400669 ; APOLD1-005; intron 2
ENST00000326765 ; APOLD1-001; intron 1
ENST00000588943 ; APOLD1-003; intron 1
ENST00000540583 ; APOLD1-004; intron 2
ENST00000534843 ; APOLD1-005; intron 2
Database links

Mature sequence hsa-miR-614

Accession MIMAT0003282
Sequence

54 - 

gaacgccuguucuugccaggugg

 - 76

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).