Stem-loop sequence hsa-mir-613

AccessionMI0003626 (change log)
Symbol HGNC:MIR613
DescriptionHomo sapiens miR-613 stem-loop
Gene family MIPF0000590; mir-613
Literature search

8 open access papers mention hsa-mir-613
(27 sentences)

Stem-loop
   ----    a   c  uuc    ugu        cc      ua    cuua 
5'     ggug gug gu   caag   gaagggac  uuccug  gugu    u
       |||| ||| ||   ||||   ||||||||  ||||||  ||||     
3'     ccac uac ca   guuu   cuuccuug  aaggau  caua    a
   auuu    a   u  -cc    ---        -u      ga    acau 
Get sequence
Deep sequencing
91 reads, 25 reads per million, 12 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 12764649-12764743 [+]
intergenic
Database links

Mature sequence hsa-miR-613

Accession MIMAT0003281
Sequence

61 - 

aggaauguuccuucuuugcc

 - 80

Get sequence
Deep sequencing86 reads, 7 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).