Stem-loop sequence hsa-mir-611

AccessionMI0003624 (change log)
Symbol HGNC:MIR611
DescriptionHomo sapiens miR-611 stem-loop
Gene family MIPF0000539; mir-611
Literature search

2 open access papers mention hsa-mir-611
(2 sentences)

Stem-loop
   aaaau   g   g g        ag   -  gac 
5'      ggu aga c uugagggg  uuc ca   g
        ||| ||| | ||||||||  ||| ||    
3'      cca ucu g ggcucccc  gag gu   g
   -acac   g   - g        ag   c  aga 
Get sequence
Deep sequencing
32 reads, 4.76 reads per million, 21 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 61792495-61792561 [-]
intergenic
Database links

Mature sequence hsa-miR-611

Accession MIMAT0003279
Sequence

40 - 

gcgaggaccccucggggucugac

 - 62

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).