Stem-loop sequence hsa-mir-609

AccessionMI0003622 (change log)
Symbol HGNC:MIR609
DescriptionHomo sapiens miR-609 stem-loop
Gene family MIPF0000516; mir-609
Literature search

6 open access papers mention hsa-mir-609
(8 sentences)

Stem-loop
   ---ug   g                 u            gu    aaug 
5'      cuc gcuguuccuaggguguu cucucaucucug  cuau    g
        ||| ||||||||||||||||| ||||||||||||  ||||     
3'      gag cgacaaggaucccacaa gggaguagagau  gaua    g
   ccaag   a                 c            --    aauu 
Get sequence
Deep sequencing
77 reads, 0 reads per million, 41 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 104218789-104218883 [-]
antisense
OTTHUMT00000462236 ; RP11-18I14.10-007; intron 2
ENST00000594818 ; RP11-18I14.10-007; intron 2
Database links

Mature sequence hsa-miR-609

Accession MIMAT0003277
Sequence

16 - 

aggguguuucucucaucucu

 - 35

Get sequence
Deep sequencing52 reads, 29 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).