Stem-loop sequence hsa-mir-608

AccessionMI0003621 (change log)
Symbol HGNC:MIR608
DescriptionHomo sapiens miR-608 stem-loop
Gene family MIPF0000972; mir-608
Literature search

23 open access papers mention hsa-mir-608
(382 sentences)

Stem-loop
   -gg   -aa g  g      -  ug  g  ---g   c     cguuuaaaa 
5'    gcc   g ug gccagg gg  gu uu    gga agcuc         a
      |||   | || |||||| ||  || ||    ||| |||||         g
3'    ugg   c ac ugguuc cc  cg aa    ccu ucgag         g
   aga   aca g  g      u  gu  g  acua   -     aaccucuac 
Get sequence
Deep sequencing
19 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 100974985-100975084 [+]
antisense
OTTHUMT00000049789 ; HPSE2-001; intron 2
OTTHUMT00000049791 ; HPSE2-003; intron 2
OTTHUMT00000049790 ; HPSE2-002; intron 2
ENST00000370552 ; HPSE2-001; intron 2
ENST00000370549 ; HPSE2-003; intron 2
ENST00000370546 ; HPSE2-002; intron 2
ENST00000404542 ; HPSE2-201; intron 2
Database links

Mature sequence hsa-miR-608

Accession MIMAT0003276
Sequence

16 - 

aggggugguguugggacagcuccgu

 - 40

Get sequence
Deep sequencing17 reads, 6 experiments
Evidence experimental; Microarray [1], SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).