Stem-loop sequence hsa-mir-606

AccessionMI0003619 (change log)
Symbol HGNC:MIR606
DescriptionHomo sapiens miR-606 stem-loop
Gene family MIPF0000780; mir-606
Literature search

3 open access papers mention hsa-mir-606
(3 sentences)

Stem-loop
   ------------      c                 u         a    ug 
5'             uguauc uugguuuuuaguaguuu acuaugaug ggug  c
               |||||| ||||||||||||||||| ||||||||| ||||  c
3'             acauag aacuaaaagucaucaaa ugauacuac ccac  a
   accaguccguga      a                 -         c    cu 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 75552458-75552553 [+]
sense
OTTHUMT00000468548 ; ZSWIM8-020; exon 1
OTTHUMT00000468549 ; ZSWIM8-014; 3'UTR (exon 1)
OTTHUMT00000468550 ; ZSWIM8-015; 3'UTR (exon 1)
OTTHUMT00000468551 ; ZSWIM8-016; 3'UTR (exon 1)
OTTHUMT00000048699 ; ZSWIM8-005; 3'UTR (exon 2)
OTTHUMT00000468541 ; ZSWIM8-027; 3'UTR (exon 10)
OTTHUMT00000468544 ; ZSWIM8-019; 3'UTR (exon 10)
OTTHUMT00000468545 ; ZSWIM8-012; 3'UTR (exon 10)
OTTHUMT00000468546 ; ZSWIM8-021; 3'UTR (exon 10)
OTTHUMT00000468542 ; ZSWIM8-018; 3'UTR (exon 11)
ENST00000431225 ; ZSWIM8-020; exon 1
ENST00000603187 ; ZSWIM8-014; 3'UTR (exon 1)
ENST00000412198 ; ZSWIM8-015; 3'UTR (exon 1)
ENST00000604754 ; ZSWIM8-016; 3'UTR (exon 1)
ENST00000492395 ; ZSWIM8-005; 3'UTR (exon 2)
ENST00000604729 ; ZSWIM8-027; 3'UTR (exon 10)
ENST00000604524 ; ZSWIM8-019; 3'UTR (exon 10)
ENST00000605216 ; ZSWIM8-012; 3'UTR (exon 10)
ENST00000433366 ; ZSWIM8-021; 3'UTR (exon 10)
ENST00000398706 ; ZSWIM8-201; 3'UTR (exon 10)
ENST00000603114 ; ZSWIM8-018; 3'UTR (exon 11)
Database links

Mature sequence hsa-miR-606

Accession MIMAT0003274
Sequence

61 - 

aaacuacugaaaaucaaagau

 - 81

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).