Stem-loop sequence hsa-mir-605

AccessionMI0003618
Symbol HGNC:MIR605
DescriptionHomo sapiens miR-605 stem-loop
Gene family MIPF0000528; mir-605
Stem-loop
   gc                   c              cu  gg 
5'   ccuagcuugguucuaaauc cauggugccuucuc  ug  a
     ||||||||||||||||||| ||||||||||||||  ||  a
3'   ggauugaacuaagauuuag guaucacggaagag  ac  a
   --                   a              --  aa 
Get sequence
Deep sequencing
82 reads, 172 reads per million, 32 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr10: 51299573-51299655 [+]
antisense
OTTHUMT00000467541 ; AGAP8-006; intron 1
OTTHUMT00000048029 ; RP11-592B15.4-001; intron 9
ENST00000602930 ; AGAP8-006; intron 1
ENST00000399508 ; RP11-592B15.3-201; intron 3
ENST00000432221 ; RP11-592B15.3-202; intron 3
ENST00000404618 ; RP11-592B15.4-001; intron 9
Database links

Mature sequence hsa-miR-605-5p

Accession MIMAT0003273
Sequence

16 - 

uaaaucccauggugccuucuccu

 - 38

Get sequence
Deep sequencing8 reads, 6 experiments
Evidence experimental; SAGE [1]
Validated targets
Predicted targets

Mature sequence hsa-miR-605-3p

Accession MIMAT0026621
Sequence

51 - 

agaaggcacuaugagauuuaga

 - 72

Get sequence
Deep sequencing44 reads, 17 experiments
Evidence experimental; Illumina [2]

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:23226537 "The repertoire and features of human platelet microRNAs" Ple H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P PLoS One. 7:e50746(2012).