Stem-loop sequence hsa-mir-601

AccessionMI0003614 (change log)
Symbol HGNC:MIR601
DescriptionHomo sapiens miR-601 stem-loop
Gene family MIPF0000522; mir-601
Literature search

12 open access papers mention hsa-mir-601
(58 sentences)

Stem-loop
   ugcaugag   gu  --u  u  --      g    a  -   ca 
5'         uuc  cu   gg cu  aggauu uugg gg agu  g
           |||  ||   || ||  |||||| |||| || |||  a
3'         agg  gg   cc ga  uccuag gacc cc uca  a
   --------   ug  uuu  u  ag      g    -  a   aa 
Get sequence
Deep sequencing
13 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 123402525-123402603 [-]
sense
OTTHUMT00000055513 ; MEGF9-001; intron 2
ENST00000373930 ; MEGF9-001; intron 2
ENST00000426959 ; MEGF9-201; intron 4
Database links

Mature sequence hsa-miR-601

Accession MIMAT0003269
Sequence

16 - 

uggucuaggauuguuggaggag

 - 37

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; Microarray [1], RT-PCR [1], SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).