Stem-loop sequence hsa-mir-548a-3

AccessionMI0003612 (change log)
Symbol HGNC:MIR548A3
DescriptionHomo sapiens miR-548a-3 stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548a-3
(170 sentences)

Stem-loop
   ccuagaaugu     g  c                 g      a     ac 
5'           uauua gu ggugcaaaaguaauugc aguuuu ccauu  u
             ||||| || ||||||||||||||||| |||||| |||||   
3'           auaau ca ccacguuuucauuaacg ucaaaa gguaa  u
   -------uuc     g  a                 g      c     cu 
Get sequence
Deep sequencing
7961 reads, 18.7 reads per million, 123 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 104484369-104484465 [-]
intergenic
Database links

Mature sequence hsa-miR-548a-5p

Accession MIMAT0004803
Sequence

25 - 

aaaaguaauugcgaguuuuacc

 - 46

Get sequence
Deep sequencing643 reads, 77 experiments
Evidence experimental; cloned [2]
Predicted targets

Mature sequence hsa-miR-548a-3p

Accession MIMAT0003251
Previous IDshsa-miR-548a
Sequence

61 - 

caaaacuggcaauuacuuuugc

 - 82

Get sequence
Deep sequencing21333 reads, 118 experiments
Evidence experimental; SAGE [1], cloned [2]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).