Stem-loop sequence hsa-mir-599

AccessionMI0003611
Symbol HGNC:MIR599
DescriptionHomo sapiens miR-599 stem-loop
Gene family MIPF0000502; mir-599
Stem-loop
   aaagacaugcu     c     --                 gg     -   u 
5'            gucca agugu  guuugauaagcugacau  gacag gga u
              ||||| |||||  |||||||||||||||||  ||||| ||| c
3'            uaggu ucaua  caaacuauuugacugug  uuguc cuu u
   --------cag     -     cc                 --     a   u 
Get sequence
Deep sequencing
58 reads, 99 reads per million, 24 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr8: 99536636-99536730 [-]
sense
OTTHUMT00000379652 ; STK3-014; intron 1
OTTHUMT00000379635 ; STK3-001; intron 10
OTTHUMT00000379636 ; STK3-002; intron 12
ENST00000517832 ; STK3-014; intron 1
ENST00000419617 ; STK3-001; intron 10
ENST00000523601 ; STK3-002; intron 12
Clustered miRNAs
< 10kb from hsa-mir-599
hsa-mir-875chr8: 99536786-99536861 [-]
hsa-mir-599chr8: 99536636-99536730 [-]
Database links

Mature sequence hsa-miR-599

Accession MIMAT0003267
Sequence

61 - 

guugugucaguuuaucaaac

 - 80

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).